Nnat (NM_001291128) Mouse Untagged Clone

CAT#: MC225797

Nnat (untagged) - Mouse neuronatin (Nnat), transcript variant 3


  "NM_001291128" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Nnat"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nnat
Synonyms 5730414I02Rik; AW107673; Peg5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225797 representing NM_001291128
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCAGTGGCAGCAGCCTCGGCAGAACTGCTCATCATCGGCTGGTACATCTTCCGCGTGCTGCTGC
AGACCCTGTCCCCAGTGCGCCCGCGCCCAGCCGGGAACAAAGACTCAGGGGTGCGGCGGTCGCCCGCTGC
GGACGATCGCGACCAACGCGGTGTTCAGGTACTCCCTGCAGAAGCTGGCGCACACGGTGTCCCGGACCGG
GCGGCAGGTGCTGGGGGAGCGCAGGCAGCGAGCCCCCAACTGAGGCCCCAGCTCCCAGCCCTGGGCGGCC
GTGTCATCAGGTGCTCCTGTGCTTCTCGACCAGCATGGGAGCCAGTGCCGCGCAGGAATGGGGGGTCCCC
TGTGTTCCCTCGTCAGAGGAGCACTTGCCAAGGTCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291128
ORF Size 390 bp
Insert Size 390
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001291128.1, NP_001278057.1
RefSeq Size 1261
RefSeq ORF 390
Locus ID 18111
Gene Summary May participate in the maintenance of segment identity in the hindbrain and pituitary development, and maturation or maintenance of the overall structure of the nervous system. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (c).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.