Gabpb1 (NM_001271469) Mouse Untagged Clone

CAT#: MC225884

Gabpb1 (untagged) - Mouse GA repeat binding protein, beta 1 (Gabpb1), transcript variant 7


  "NM_001271469" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gabpb1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gabpb1
Synonyms BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4Tf1B; GABPB; GABPB-1; GABPB-2; GABPB1-1; GABPB1-2; NRF2B1; NRF2B2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225884 representing NM_001271469
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCTGGTAGATTTGGGGAAGAAGCTTTTAGAAGCGGCACGAGCCGGTCAAGATGATGAAGTTCGCA
TTTTGATGGCAAATGGAGCTCCTTTTACTACAGACTGGTTGGGAACTTCTCCACTTCATCTGGCCGCACA
GTATGGGCATTTCTCTACCACAGAGGTTCTTCTCCGAGCCGGTGTAAGTAGAGATGCCAGGACCAAAGTG
GACCGGACACCACTGCACATGGCGGCTTCTGAGGGCCATGCCAACATAGTAGAAGTTTTGCTTAAGGAGA
GAGAAGCGCTTCAGAAACAGCTGGATGAAGCCAACCGAGAGGCCCAGAAATACCGACAGCAGCTGCTTAA
GAAGGAGCAGGAGGCAGAGGCCTACAGGCAGAAGCTGGAGGCCATGACACGCATCCAGACCAACAAAGAA
GCCGTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271469
ORF Size 429 bp
Insert Size 429
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001271469.1, NP_001258398.1
RefSeq Size 1989
RefSeq ORF 429
Locus ID 14391
Gene Summary Transcription factor capable of interacting with purine rich repeats (GA repeats). [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) lacks several alternate in-frame exons in the coding region compared to variant 1. The resulting protein (isoform f) uses the same start codon but is shorter than isoform a. PubMed ID: 15656975 suggests that this protein lacks a nuclear localization signal found in isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.