Gabpb1 (NM_001271469) Mouse Untagged Clone

CAT#: MC225884

Gabpb1 (untagged) - Mouse GA repeat binding protein, beta 1 (Gabpb1), transcript variant 7

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gabpb1
• Synonyms: BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4Tf1B; GABPB; GABPB-1; GABPB-2; GABPB1-1; GABPB1-2; NRF2B1; NRF2B2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225884 representing NM_001271469
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCCTGGTAGATTTGGGGAAGAAGCTTTTAGAAGCGGCACGAGCCGGTCAAGATGATGAAGTTCGCA
  TTTTGATGGCAAATGGAGCTCCTTTTACTACAGACTGGTTGGGAACTTCTCCACTTCATCTGGCCGCACA
  GTATGGGCATTTCTCTACCACAGAGGTTCTTCTCCGAGCCGGTGTAAGTAGAGATGCCAGGACCAAAGTG
  GACCGGACACCACTGCACATGGCGGCTTCTGAGGGCCATGCCAACATAGTAGAAGTTTTGCTTAAGGAGA
  GAGAAGCGCTTCAGAAACAGCTGGATGAAGCCAACCGAGAGGCCCAGAAATACCGACAGCAGCTGCTTAA
  GAAGGAGCAGGAGGCAGAGGCCTACAGGCAGAAGCTGGAGGCCATGACACGCATCCAGACCAACAAAGAA
  GCCGTTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271469
• ORF Size: 429 bp
• Insert Size: 429
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001271469.1, NP_001258398.1
• RefSeq Size: 1989
• RefSeq ORF: 429
• Locus ID: 14391
• Gene Summary: Transcription factor capable of interacting with purine rich repeats (GA repeats). [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (7) lacks several alternate in-frame exons in the coding region compared to variant 1. The resulting protein (isoform f) uses the same start codon but is shorter than isoform a. PubMed ID: 15656975 suggests that this protein lacks a nuclear localization signal found in isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.