Il15 (NM_001254747) Mouse Untagged Clone

CAT#: MC226014

Il15 (untagged) - Mouse interleukin 15 (Il15), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Il15
• Synonyms: AI503618; IL-15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226014 representing NM_001254747
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAAATTTTGAAACCATATATGAGGAATACATCCATCTCGTGCTACTTGTGTTTCCTTCTAAACAGTC
  ACTTTTTAACTGAGGCTGGCATTCATGTCTTCATTTTGGGCTGTGTCAGTGTAGGTCTCCCTAAAACAGA
  GGCCAACTGGATAGATGTAAGATATGACCTGGAGAAAATTGAAAGCCTTATTCAATCTATTCATATTGAC
  ACCACTTTATACACTGACAGTGACTTTCATCCCAGTTGCAAAGTTACTGCAATGAACTGCTTTCTCCTGG
  AATTGCAGGTTATTTTACATGAGTACAGTAACATGACTCTTAATGAAACAGTAAGAAACGTGCTCTACCT
  TGCAAACAGCACTCTGTCTTCTAACAAGAATGTAGCAGAATCTGGCTGCAAGGAATGTGAGGAGCTGGAG
  GAGAAAACCTTCACAGAGTTTTTGCAAAGCTTTATACGCATTGTCCAAATGTTCATCAACACGTCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001254747
• ORF Size: 489 bp
• Insert Size: 489
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001254747.1, NP_001241676.1
• RefSeq Size: 1287
• RefSeq ORF: 489
• Locus ID: 16168
• Gene Summary: This gene encodes a a pleiotropic cytokine of the interleukin family of proteins that plays important roles in the innate and adaptive cell homeostasis, as well as peripheral immune function. The encoded protein undergoes proteolytic processing to generate a mature cytokine that stimulates the proliferation of natural killer cells. The transgenic mice overexpressing the encoded protein exhibit an increase in the number of memory CD8+ T cells in a naive state and enhanced protection against bacterial infections. Mice lacking the encoded protein exhibit impaired protection against a strain of attenuated Mycobacterium. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.