Cxadr (NM_001276263) Mouse Untagged Clone

CAT#: MC226027

Cxadr (untagged) - Mouse coxsackie virus and adenovirus receptor (Cxadr), transcript variant 3


  "NM_001276263" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cxadr"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cxadr
Synonyms 2610206D03Rik; AU016810; AW553441; CAR; MCAR; MCVADR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226027 representing NM_001276263
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCGCCTACTGTGCTTCGTGCTCTTGTGCGGGATCGCGGATTTCACCAGTGGTTTGAGCATCACTA
CACCCGAACAGAGGATCGAAAAAGCCAAAGGGGAAACTGCGTATCTACCATGCAAGTTTACTCTCAGTCC
CGAAGACCAGGGACCACTGGACATTGAATGGCTGATATCCCCGTCTGATAACCAGATAGTGGATCAAGTG
ATCATTTTGTATTCTGGAGACAAAATTTATGATAACTACTATCCGGATCTGAAAGGACGGGTACATTTTA
CGAGTAACGATGTCAAGTCTGGCGACGCATCTATAAATGTGACCAACCTGCAGCTGTCGGACATTGGCAC
TTACCAGTGCAAAGTGAAGAAAGCCCCTGGGGTTGCAAATAAGAAATTCCTGCTGACCGTTCTTGGTAAG
TCATCGTTCCTATTATCCACAGGGGTGGAGTGGGGTGGGGGTGCGGAGTTACAAGGTGGCAGGGAAGGTG
GCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276263
ORF Size 495 bp
Insert Size 495
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001276263.1, NP_001263192.1
RefSeq Size 1386
RefSeq ORF 495
Locus ID 13052
Gene Summary This gene encodes a protein that is part of the Cortical Thymocyte marker in Xenopus (CTX) subfamily within the immunoglobulin superfamily. Members of this subfamily, predominantly expressed on the surface of endothelial and epithelial cells, help establish cell polarity and provide a barrier function, regulating migration of immune cells. This protein, first identified as the receptor for adenovirus subgroup C and coxsakieviruses group B, is developmentally regulated and plays an important role in cardiac development. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) includes an alternate terminal 3' exon and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (c) has a distinct and shorter C-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.