Cxadr (NM_001276263) Mouse Untagged Clone

CAT#: MC226027

Cxadr (untagged) - Mouse coxsackie virus and adenovirus receptor (Cxadr), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cxadr
• Synonyms: 2610206D03Rik; AU016810; AW553441; CAR; MCAR; MCVADR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226027 representing NM_001276263
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCGCCTACTGTGCTTCGTGCTCTTGTGCGGGATCGCGGATTTCACCAGTGGTTTGAGCATCACTA
  CACCCGAACAGAGGATCGAAAAAGCCAAAGGGGAAACTGCGTATCTACCATGCAAGTTTACTCTCAGTCC
  CGAAGACCAGGGACCACTGGACATTGAATGGCTGATATCCCCGTCTGATAACCAGATAGTGGATCAAGTG
  ATCATTTTGTATTCTGGAGACAAAATTTATGATAACTACTATCCGGATCTGAAAGGACGGGTACATTTTA
  CGAGTAACGATGTCAAGTCTGGCGACGCATCTATAAATGTGACCAACCTGCAGCTGTCGGACATTGGCAC
  TTACCAGTGCAAAGTGAAGAAAGCCCCTGGGGTTGCAAATAAGAAATTCCTGCTGACCGTTCTTGGTAAG
  TCATCGTTCCTATTATCCACAGGGGTGGAGTGGGGTGGGGGTGCGGAGTTACAAGGTGGCAGGGAAGGTG
  GCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276263
• ORF Size: 495 bp
• Insert Size: 495
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001276263.1, NP_001263192.1
• RefSeq Size: 1386
• RefSeq ORF: 495
• Locus ID: 13052
• Gene Summary: This gene encodes a protein that is part of the Cortical Thymocyte marker in Xenopus (CTX) subfamily within the immunoglobulin superfamily. Members of this subfamily, predominantly expressed on the surface of endothelial and epithelial cells, help establish cell polarity and provide a barrier function, regulating migration of immune cells. This protein, first identified as the receptor for adenovirus subgroup C and coxsakieviruses group B, is developmentally regulated and plays an important role in cardiac development. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (3) includes an alternate terminal 3' exon and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (c) has a distinct and shorter C-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.