Shox2 (NM_001302359) Mouse Untagged Clone

CAT#: MC226179

Shox2 (untagged) - Mouse short stature homeobox 2 (Shox2), transcript variant 4


  "NM_001302359" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Shox2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Shox2
Synonyms 6330543G17Rik; OG12; Og12x; Prx3; SHOT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226179 representing NM_001302359
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGACGAAGGCCAGACCAAAATCAAGCAGAGGCGAAGTCGGACCAATTTTACCCTGGAACAACTCA
ACGAGCTGGAGAGGCTTTTCGATGAGACCCACTATCCAGACGCTTTCATGCGCGAGGAATTGAGCCAGCG
ACTGGGGCTCTCTGAGGCCCGAGTACAGGTTTGGTTTCAAAATCGAAGAGCTAAGTGTAGAAAACAGGAA
AATCAACTTCACAAAGGTGTCCTTATAGGAGCCGCTAGCCAGTTTGAAGCTTGTAGAGTTGCACCCTATG
TCAACGTAGGTGCTTTAAGGATGCCATTTCAGCAGGTTCAGGCGCAGCTGCAGCTGGACAGCGCCGTGGC
GCACGCGCACCACCACCTGCATCCGCACCTGGCCGCGCACGCGCCTTACATGATGTTCCCGGCACCGCCC
TTCGGACTGCCGCTGGCCACGCTGGCCGCGGACTCGGCCTCGGCCGCCTCGGTGGTGGCCGCTGCCGCCG
CCGCCAAGACCACCAGCAAGAACTCCAGCATCGCGGATCTCAGACTGAAAGCTAAAAAGCACGCGGCCGC
CCTGGGTCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302359
ORF Size 573 bp
Insert Size 573
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302359.1, NP_001289288.1
RefSeq Size 1081
RefSeq ORF 573
Locus ID 20429
Gene Summary May be a growth regulator and have a role in specifying neural systems involved in processing somatosensory information, as well as in face and body structure formation. May also have a role in heart development. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses a downstream alternate 5'-terminal exon and uses an alternate in-frame splice site in the 3' terminal exon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. Both variants 3 and 4 encode the same isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.