Rcan2 (NM_001286654) Mouse Untagged Clone

CAT#: MC226225

Rcan2 (untagged) - Mouse regulator of calcineurin 2 (Rcan2), transcript variant 4


  "NM_001286654" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rcan2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rcan2
Synonyms Csp2; Dscr1l1; MCIP2; ZAKI-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226225 representing NM_001286654
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGCCCCTAGCATGGACTGTGATGTTTCCACTCTGGTCGCCTGTGTGGTGGATGTGGAGGTCTTTA
CCAATCAGGAGGTTAAGGAAAAATTCGAGGGACTGTTCCGGACCTATGATGAATGTGTGACGTTCCAGCT
GTTTAAGAGTTTCCGACGGGTTCGAATAAATTTCAGCCATCCCAAATCTGCAGCCCGTGCCCGGATAGAG
CTTCATGAGACTCAGTTCAGAGGGAAGAAGCTAAAACTCTACTTCGCCCAGGTCCAGACCCCAGAGACAG
ATGGAGACAAACTGCATTTGGCACCTCCACAGCCTGCCAAACAGTTCCTCATCTCACCCCCTTCATCTCC
TCCTGTTGGCTGGAAGCCTATCAGCGATGCCACACCAGTCCTCAACTATGACCTTCTTTATGCTGTGGCC
AAACTAGGACCAGGAGAGAAATATGAGCTGCACGCTGGAACTGAGTCTACACCGAGCGTCGTGGTGCATG
TGTGTGACAGCGACATGGAGGAGGAGGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATCCAGACCCG
GCGTCCCGGCCTGCCACCCTCCGTGTCCAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286654
ORF Size 594 bp
Insert Size 594
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001286654.1, NP_001273583.1
RefSeq Size 3107
RefSeq ORF 594
Locus ID 53901
Gene Summary Inhibits calcineurin-dependent transcriptional responses by binding to the catalytic domain of calcineurin A. Could play a role during central nervous system development. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, compared to variant 1. The resultign isoform (2) has a shorter and distinct N-terminus, compared to isoform 1. Variants 2 and 4 encode the same isoform 2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.