Rab18 (NM_001278447) Mouse Untagged Clone

CAT#: MC226332

Rab18 (untagged) - Mouse RAB18, member RAS oncogene family (Rab18), transcript variant 1


  "NM_001278447" in other vectors (1)

Reconstitution Protocol

USD 220.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rab18"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rab18
Synonyms AA959686
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226332 representing NM_001278447
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGAGGACGTGCTGACCACTCTGAAGATACTCATCATCGGCGAGAGTGGGGTGGGCAAGTCCAGCC
TGCTCCTGAGGTTCACAGATGATACCTTTGATCCAGAACTTGCAGCAACAATAGAATTTTCATTTCTTCA
AGGTGTTGACTTTAAGGTGAAAACGATTTCAGTGGATGGAAATAAGGCTAAACTTGCAATATGGGATACA
GCTGGTCAAGAGAGGTTCAGAACATTAACTCCCAGCTATTATAGAGGTGCACAGGGAGTTATATTAGTCT
ATGATGTCACAAGAAGAGACACCTTTGTTAAACTGGATAACTGGTTAAATGAATTGGAAACATACTGTAC
AAGAAATGACATAGTAAACATGCTAGTTGGAAATAAAATTGATAAGGAAAACCGTGAAGTCGATAGAAAT
GAAGGCTTGAAATTTGCACGCAAGCATTCTATGTTGTTCATAGAGGCAAGTGCAAAAACCTGTGATGGTG
TACAGTGTGCCTTTGAGGAGCTTGTTGAGAAGATCATTCAGACACCTGGCCTGTGGGAAAGTGAGAACCA
GAACAAAGGAGTCAAGCTGTCACACAGGGAAGAGAGCCGCGGAGGAGGCGCCTGCGGCGGTTACTGCTCT
GTGCTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001278447
ORF Size 639 bp
Insert Size 639
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001278447.1, NP_001265376.1
RefSeq Size 3688
RefSeq ORF 639
Locus ID 19330
Gene Summary This gene encodes a member of the Ras-related small GTPases, which regulate membrane trafficking in organelles and transport vesicles. This protein is expressed predominantly in lipid droplets, organelles that store neutral lipids, and is proposed to play a role in lipolysis and lipogenesis. In humans mutations in this gene are associated with Warburg micro syndrome type 3. A pseudogene of this gene is located on chromosome X. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.