Pdyn (NM_001286502) Mouse Untagged Clone

CAT#: MC226553

Pdyn (untagged) - Mouse prodynorphin (Pdyn), transcript variant 2


  "NM_001286502" in other vectors (1)

Reconstitution Protocol

USD 250.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pdyn"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pdyn
Synonyms Dyn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226553 representing NM_001286502
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTGGTCCAGGCTGATGCTGGCAGCTTGCCTCCTCGTGATGCCCTCTAATGTTATGGCGGACTGCC
TGTCCCTGTGCTCCCTGTGTGCAGTGAGGATTCAGGATGGGCCCCGTCCCATCAACCCCCTGATTTGCTC
CCTGGAGTGCCAGGACCTGGTGCCGCCCTCAGAGGAGTGGGAGACATGCCGGGGCTTCTCATCTTTTCTC
ACCCTGACGGTCTCTGGGCTCCGTGGCAAGGATGACTTGGAAGATGAGGTTGCTTTGGAAGAAGGCTACA
GTGCACTAGCCAAGCTCTTGGAACCCGTCCTGAAGGAGCTGGAGAAAAGCCGACTCCTTACCAGCGTCCC
AGAGGAAAAGTTCAGGGGTCTCTCCAGCAGCTTTGGCAACGGAAAAGAATCTGAGCTGGCGGGTGCTGAC
CGGATGAATGATGAAGCCGCACAGGCGGGCACGCTCCATTTTAATGAGGAGGACTTGAGAAAACAGGCCA
AACGCTATGGCGGCTTTTTGCGCAAATACCCCAAGAGGAGTTCCGAGATGGCCCGGGATGAGGACGGGGG
CCAGGATGGGGATCAGGTAGGGCATGAGGACCTGTACAAACGCTATGGGGGCTTCCTGCGGCGCATTCGC
CCCAAGCTGAAGTGGGACAACCAGAAGCGCTATGGTGGTTTCCTGCGGCGTCAGTTCAAGGTGGTGACGC
GGTCCCAGGAGAACCCCAATACCTATTCTGAAGATTTAGATGTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286502
ORF Size 747 bp
Insert Size 747
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001286502.1, NP_001273431.1
RefSeq Size 2316
RefSeq ORF 747
Locus ID 18610
Gene Summary This gene encodes a preproprotein that is proteolytically cleaved to yield a number of active opium-like peptides. These peptides are the endogenous ligands for the Kappa-opioid receptor and similar G-protein-coupled receptors and are thought to function as the body's natural way to control addiction. These peptides have been associated with depression, stress, anxiety, response to pain, and maintenance of homeostasis via circadian rhythms and control of appetite. Mutations in the related human gene have been linked to the neurodegenerative disease spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.