Tnnt1 (NM_001277904) Mouse Untagged Clone

CAT#: MC226580

Tnnt1 (untagged) - Mouse troponin T1, skeletal, slow (Tnnt1), transcript variant 3


  "NM_001277904" in other vectors (1)

Reconstitution Protocol

USD 270.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tnnt1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tnnt1
Synonyms AW146156; ssTnT; sTnT; Tnt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226580 representing NM_001277904
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCAGACACCGAAGAACAAGAATATGAGGAGGAGCAGGCAGAAGATGAGGAAGCGGTGGAGGAGGAGG
AAGAAGAGCGCCCCAAACCCAGCCGTCCTGTGGTGCCTCCTTTGATTCCCCCGAAGATTCCAGAAGGGGA
GCGTGTGGATTTTGATGACATCCACCGGAAGCGCATGGAGAAAGACTTACTGGAGCTGCAGACGCTCATC
GACGTGCACTTTGAACAGCGGAAAAAGGAGGAGGAAGAGCTCATTGCACTAAAAGACCGCATTGAGAGGC
GACGCGCAGAGAGAGCTGAGCAACAGCGCTTCAGAACGGAAAAGGAGCGAGAACGCCAGGCCAAGCTGGC
GGAGGAGAAGATGCGGAAGGAGGAGGAGGAGGCAAAGAAGAGAGCAGAGGATGACGCCAAGAAGAAGAAA
GTTCTGTCCAACATGGGAGCTCATTTTGGGGGCTACCTGGTCAAGGCAGAACAGAAGCGTGGGAAGCGAC
AGACTGGTCGGGAGATGAAACTCCGGATTCTGTCTGAGAGGAAAAAGCCCTTGAACATCGACTACATGGG
GGAGGACCAGCTCCGGGAAAAGGCCCAGGAGCTGTCAGAATGGATCCACCAGCTGGAATCAGAAAAATTT
GACCTGATGGAGAAGTTGAAGCAACAGAAATATGAGATCAATGTGCTCTACAACCGCATCAGCCACGCCC
AGAAATTCCGAAAGGGGGCTGGGAAGGGTCGAGTTGGAGGCCGCTGGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277904
ORF Size 753 bp
Insert Size 753
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001277904.1, NP_001264833.1
RefSeq Size 994
RefSeq ORF 753
Locus ID 21955
Gene Summary This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 3, also known as low Mr isoform), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.