Rnaseh1 (NM_001286865) Mouse Untagged Clone

CAT#: MC226630

Rnaseh1 (untagged) - Mouse ribonuclease H1 (Rnaseh1), transcript variant 1


  "NM_001286865" in other vectors (1)

Reconstitution Protocol

USD 270.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rnaseh1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rnaseh1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226630 representing NM_001286865
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCTATGCGGTGAGGAGAGGCCGCAGGACCGGAGTCTTCCTGAGTTGGAGTGAGTGCAAAGCCCAGG
TGGACCGGTTTCCTGCTGCCAGGTTTAAGAAATTTGCCACAGAAGATGAGGCCTGGGCCTTTGTCAGGAG
CTCTTCAAGCCCGGATGGTTCAAAAGGGCAGGAAAGTGCACATGAGCAGAAGTCACAGGCGAAGACCAGC
AAGCGGCCTCGGGAGCCCCTGGGTGAAGGGGAAGAACTTCCAGAGCCAGGGCCGAAGCACACACGACAGG
ACACCGAGCCCTCGGCTGTAGTGAGCAAGGACGCATTTTCTTATATGGGAGAGTCAGTCGTTGTCTACAC
GGATGGCTGTTGCTCCAGTAATGGACGGAAGCGGGCACGAGCAGGAATTGGCGTTTACTGGGGCCCAGGC
CACCCCTTAAATGTAGGTATAAGGCTTCCTGGGCGACAGACAAACCAGAGGGCCGAGATCCATGCAGCCT
GCAAGGCCATCATGCAAGCCAAGGCTCAGAACATCAGCAAGCTGGTTCTGTACACAGACAGCATGTTCAC
CATCAATGGGATAACTAACTGGGTTCAGGGCTGGAAGAAGAATGGCTGGAGAACAAGTACAGGGAAAGAT
GTGATCAACAAGGAGGACTTCATGGAGCTGGACGAGCTCACTCAGGGCATGGACATCCAGTGGATGCACA
TTCCTGGTCACTCAGGATTTGTGGGCAATGAAGAGGCCGACAGACTGGCACGGGAAGGAGCGAAGCAGTC
TGAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286865
ORF Size 780 bp
Insert Size 780
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001286865.1, NP_001273794.1
RefSeq Size 1472
RefSeq ORF 780
Locus ID 19819
Gene Summary This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and is necessary for DNA replication and repair. This enzyme is present in both mitochondria and nuclei, which are resulted from translation of a single mRNA with two in-frame initiation start codons. The use of the first start codon produces the mitochondrial isoform and the use of the second start codon produces the nuclear isoform. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF) which encodes 7aa in mouse. An alternately spliced transcript variant has been found which is a candidate for nonsense-mediated mRNA decay (NMD). [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (1) is derived from the upstream AUG start codon, while the shorter isoform (2) is derived from the downstream AUG start codon. This RefSeq represents the shorter isoform (2), which is a nuclear protein (see details in PMID: 20823270).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.