Hoxa9 (NM_001277238) Mouse Untagged Clone

CAT#: MC226863

Hoxa9 (untagged) - Mouse homeobox A9 (Hoxa9), transcript variant 2


  "NM_001277238" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hoxa9"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hoxa9
Synonyms D6a9; Hox-1.7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226863 representing NM_001277238
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTTTGCTATAAAAATTATGACTGCAAAACACCGGGCCATTAATAGCGTGCGGAGTGATTTACGCG
TTATTGTTCTGCCGGGCGGACACGTGACGCGCGTGGCCAATGGGGGCGCGGGCGCCGGCAACTTATTAGG
TGACTGTACTTCACCCCCCCCTGGTGCCACCAAGTTGTTACATGAAATCTGCAGTTTCATAATTTCGGCG
GGTCGGGCTGGGCCGGCCAGGCGCGGGCTACTGCAATGGCCACCACCGGGGCCCTGGGCAACTACTATGT
GGACTCCTTCCTGCTGGGCGCCGACGCTGCTGATGAGCTGGGTGCGGGACGCTACGCTCCAGGGACCCTG
GGTCAACCCCCAAGGCAGGCGGCAGCTCTGGCCGAACACCCCGACTTCAGTCCTTGCAGCTTCCAGTCCA
AGGCGGCGGTGTTTGGTGCCTCGTGGAACCCAGTGCACGCGGCGGGCGCCAATGCGGTGCCTGCTGCAGT
GTATCATCACCACCACCACCCCTACGTGCATCCCCAGGCGCCCGTGGCGGCGGCGGCGCCGGACGGCAGT
TGATAGAGAAAAACAACCCAGCGAAGGCGCCTTCTCCGAAAACAATGCCGAGAATGAGAGCGGCGGAGAC
AAGCCCCCCATCGATCCCAATAACCCGGCTGCCAACTGGCTACATGCTCGCTCCACTCGGAAGAAGCGAT
GCCCCTACACAAAACACCAGACGCTGGAACTGGAGAAGGAGTTTCTGTTTAACATGTACCTCACACGGGA
CCGCAGGTACGAGGTGGCCCGGCTGCTCAACCTCACCGAAAGGCAGGTCAAGATCTGGTTCCAGAACCGC
AGGATGAAAATGAAGAAAATCAACAAGGACCGAGCAAAAGACGAGTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001277238
ORF Size 888 bp
Insert Size 888
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001277238.1, NP_001264167.1
RefSeq Size 3056
RefSeq ORF 888
Locus ID 15405
Gene Summary This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of similar genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is important for hematopoeisis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (2) lacks an internal segment in the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is longer than isoform 1. The exon structure of this variant is similar to Hoxa9T (PMID: 9524228). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.