Selenop (NM_001042613) Mouse Untagged Clone

CAT#: MC227396

Sepp1 (untagged) - Mouse selenoprotein P, plasma, 1 (Sepp1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Selenop
• Synonyms: AU018766; D15Ucla1; Se-P; selp; Sepp1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227396 representing NM_001042613
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTGGAGAAGCCTAGGGCTTGCCCTGGCTCTCTGTCTCCTCCCCTATGGAGGAGCAGAGAGCCAAGGCC
  AAAGCTCTGCTTGTTACAAAGCCCCGGAGTGGTACATAGGAGATCAAAATCCAATGCTAAACTCAGAGGG
  CAAAGTGACAGTGGTTGCTCTTCTTCAAGCCAGCTGATACTTGTGTCTTCTGCAGGCATCCAGATTGGAA
  GACCTGCGCATAAAACTAGAAAGCCAAGGATATTTTAACATCTCTTACATTGTTGTTAACCATCAAGGAT
  CTCCTTCCCAATTAAAACACTCACATCTTAAAAAGCAGGTGTCAGAACACATCGCAGTGTACAGACAAGA
  AGAAGATGGCATAGATGTCTGGACTCTCTTAAATGGAAACAAAGATGACTTCCTCATCTATGACAGATGT
  GGCCGTCTTGTGTATCACCTTGGTTTGCCTTACTCCTTCCTCACATTCCCATATGTTGAAGAAGCCATTA
  AGATCGCTTACTGTGAGGAGAGGTGCGGAAACTGCAATCTCACGAGTCTTGAAGATGAAGACTTCTGTAA
  AACTGTGACCTCAGCTACTGCCAATAAAACTGCGGAGCCCTCAGAGGCTCATAGCCACCACAAACACCAC
  AACAAACATGGGCAGGAGCATCTTGGCAGCAGTAAGCCTTCAGAGAATCAGCAACCAGGGCCATCAGAGA
  CGACTCTGCCTCCTTCAGGCTTGCACCACCACCACAGGCATAGGGGCCAGCACAGGCAGGGTCACTTAGA
  GAGCTGAGACACCACAGCAAGTGAAGGCTTGCACCTTTCACTTGCCCAGAGGAAGCTCTGACGAAGGGGG
  TGCATCAACCAGCTCCTGTGTAAGTTGTCTAAGGAGTCCGAGGCAGCCCCCAGCAGCTGCTGCTGTCACT
  GCCGCCACCTCATATTTGAGAAGTCAGGGTCTGCAATTGCTTGACAGTGTGCGGAAAACCTCCCATCCTT
  ATGTAGCTGACAGGGGCTTTTCGCGGAGGAGAAAGTCACTGAATCCTGTCAGTGTAGGTCACCTCCAGCT
  GCCTGACAAAATCAGCCCATGAACCCCATGGAAGCCAACCCCAACTGAAGCTGAGATAATCAGACCAGGA
  AGTGAAAATGACATTCAAACTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001042613
• ORF Size: 1143 bp
• Insert Size: 1143
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001042613.1, NP_001036078.1
• RefSeq Size: 2013
• RefSeq ORF: 1143
• Locus ID: 20363
• Gene Summary: This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in mouse), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. Alternatively spliced transcript variants differing in 5' non-coding region have been described for this gene. Expression of these variants varies in different tissues and developmental stages (PMID:23064117). [provided by RefSeq, Feb 2017]
  Transcript Variant: This variant (2, also known as Sepp1b) uses an alternate 5' non-coding exon, hence has a different 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein containing 10 selenocysteine residues. Variant Sepp1b is specifically localized to the hippocampus in the brain, and is a specific target for regulation by miR-7 microRNA (PMID:23064117).