Gng13 (NM_022422) Mouse Tagged ORF Clone
CAT#: MR200057
- TrueORF®
Gng13 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 13 (Gng13)
"NM_022422" in other vectors (4)
Interest in protein/lysate? Submit request here!
Product Images
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Symbol | Gng13 |
Synonyms | 1500031D04Rik; AB030194; Ggamma13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR200057 representing NM_022422
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGAGTGGGATGTGCCCCAGATGAAGAAGGAGGTAGAGAGCCTCAAGTACCAACTGGCCTTCAAGA GGGAGATGTCGTCCAAGACCATCCCCGAGCTTCTCAAGTGGATTGAGGATGGAATCCCCAAGGACCCCTT CCTGAACCCAGACCTGATGAAGAACAACCCTTGGGTAGAGAAGGCCAAGTGCACCATCCTA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_022422 |
ORF Size | 201 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Reference Data | |
RefSeq | NM_022422.1, NM_022422.2, NM_022422.3, NM_022422.4, NM_022422.5, NP_071867.1 |
RefSeq Size | 438 |
RefSeq ORF | 204 |
Locus ID | 64337 |
MW | 8.4 kDa |
Gene Summary | Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC204951 | Gng13 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 13 (Gng13), (10ug) |
USD 210.00 |
|
MG200057 | Gng13 (GFP-tagged) - Mouse guanine nucleotide binding protein 13, gamma (Gng13) |
USD 300.00 |
|
MR200057L3 | Lenti ORF clone of Gng13 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 13 (Gng13) |
USD 500.00 |
|
MR200057L4 | Lenti ORF clone of Gng13 (mGFP-tagged) - Mouse guanine nucleotide binding protein (G protein), gamma 13 (Gng13) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review