Gng13 (NM_022422) Mouse Untagged Clone

CAT#: MC204951

Gng13 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 13 (Gng13), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gng13
• Synonyms: 1500031D04Rik; AB030194; Ggamma13
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC059712
  GGGGCGTCTCGGGGTGCACCGGCGGCCGGGCTCCGGCGGCGGCAGCAGCGCAGCCTCAGGCTGGCTACCA CCGACGCCCCCGACGCCATGGAGGAGTGGGATGTGCCCCAGATGAAGAAGGAGGTAGAGAGCCTCAAGTA CCAACTGGCCTTCAAGAGGGAGATGTCGTCCAAGACCATCCCCGAGCTTCTCAAGTGGATTGAGGATGGA ATCCCCAAGGACCCCTTCCTGAACCCAGACCTGATGAAGAACAACCCTTGGGTAGAGAAGGCCAAGTGCA CCATCCTATGAGCCTGACCCACACTCTCTGTAAGGTGTGACTTTATAAATAGACTTCTCCGGGTGCCAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: SfiI-SfiI
• ACCN: NM_022422
• ORF Size: 204 bp
• Insert Size: 204
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC059712, AAH59712
• RefSeq Size: 377
• RefSeq ORF: 204
• Locus ID: 64337
• Gene Summary: Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. [UniProtKB/Swiss-Prot Function]