Ccng1 (BC005534) Mouse Tagged ORF Clone
CAT#: MR203177
- TrueORF®
Ccng1 (Myc-DDK-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034)
"BC005534" in other vectors (4)
Interest in protein/lysate? Submit request here!
Product Images
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Symbol | Ccng1 |
Synonyms | Ccng, cyclin G |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR203177 representing BC005534
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | BC005534 |
ORF Size | 747 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Reference Data | |
RefSeq | BC005534, AAH05534 |
RefSeq Size | 3151 |
RefSeq ORF | 749 |
Locus ID | 12450 |
MW | 115.5 kDa |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC218146 | Ccng1 (untagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034), (10ug) |
USD 730.00 |
|
MG203177 | Ccng1 (GFP-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034) |
USD 290.00 |
|
MR203177L3 | Lenti ORF clone of Ccng1 (Myc-DDK-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034) |
USD 460.00 |
|
MR203177L4 | Lenti ORF clone of Ccng1 (mGFP-tagged) - Mouse cyclin G1 (cDNA clone MGC:7684 IMAGE:3497034) |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review