Ndufaf3 (NM_001033971) Rat Untagged Clone
CAT#: RN200350
Ndufaf3 (untagged ORF) - Rat nuclear protein E3-3 (RGD708545), transcript variant 2, (10 ug)
"NM_001033971" in other vectors (3)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Ndufaf3 |
Synonyms | RGD708545 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200350 representing NM_001033971
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCACTGCTCTAGGATTTCGCTGCCTTTACCGAACGCGACCTGCGACGCTCGGTCGGAGGAGCCCGA GTCGGGGGCACCGGCTTTCTCCGGCTGACGATGAGTTATACCAGCGGACGCGTATCTCTTTGCTGCAAAA CGAGTTCCCTCAGGCCGTATACATCGACAGCTACAATAGCAGAGGTTTCACTATCAACGGAAACCGCGTG TTTGGACCTTGTGCGCTGCTCCCACAGACCGTGGTCCAGTGGAACGTGGGATCTCATCAGGATATCACTG AAGAGAGCTTCTCGATTTTCTGGATGCTGGAACCTAGGATAGAGATTGTTGTGGTGGGCACCGGAAACAA GACTGAGCGGCTGCACTCTCAAGTCCTGCAGGCCATGAGGCAGCGGGGAATTGCGGTGGAGATACAGGAC ACGCCTAACGCCTGTGCCACCTTCAACTTCCTGTGCCACGAAGGTCGAGTGACAGGAGCTGCCCTCATCC CCCCACCTGGAGAGACTGCACTTGCCTCTTCTGGTCAAACCACAGAGTGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001033971 |
Insert Size | 540 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033971.2, NP_001029143.1 |
RefSeq Size | 1447 bp |
RefSeq ORF | 540 bp |
Locus ID | 56769 |
Cytogenetics | 8q32 |
Gene Summary | This gene encodes a protein that is required for assembly of mitochondrial NADH: ubiquinone oxidoreductase complex I, a multiprotein enzyme complex that is part of the oxidative phosphorylation pathway. In humans, mutations in this gene are associated with fatal neonatal mitochondrial disease and lactic acidosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. It encodes isoform b, which is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200350 | Ndufaf3 (Myc-DDK-tagged ORF) - Rat nuclear protein E3-3 (RGD708545), transcript variant 2, (10 ug) |
USD 420.00 |
|
RR200350L3 | Lenti ORF clone of Ndufaf3 (Myc-DDK-tagged ORF) - Rat nuclear protein E3-3 (RGD708545), transcript variant 2, (10 ug) |
USD 640.00 |
|
RR200350L4 | Lenti ORF clone of Ndufaf3 (mGFP-tagged ORF) - Rat nuclear protein E3-3 (RGD708545), transcript variant 2, (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review