Cav1 (NM_133651) Rat Untagged Clone

CAT#: RN200415

Cav1 (untagged ORF) - Rat caveolin 1, caveolae protein (Cav1), transcript variant 2, (10 ug)


  "NM_133651" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cav1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cav1
Synonyms Cav
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200415 representing NM_133651
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGACGAGGTGAATGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATTGATCTGGTCAACCGCG
ACCCCAAGCATCTCAACGACGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCGGAACCAGAAGGGAC
ACACAGTTTCGACGGCATCTGGAAGGCCAGCTTCACCACCTTCACTGTGACAAAATATTGGTTTTACCGC
TTGCTGTCTACCATCTTCGGCATCCCTATGGCGCTCATCTGGGGCATCTACTTTGCCATCCTCTCTTTCC
TGCACATCTGGGCAGTTGTACCGTGCATCAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTA
TTCCATCTACGTCCACACCTTCTGTGATCCACTCTTTGAAGCGATTGGCAAGATATTCAGCAATATCCGC
ATCAGCACGCAGAAAGAGATATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133651
ORF Size 444 bp
Insert Size 444
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_133651.2, NP_598412.2
RefSeq Size 2576
RefSeq ORF 444
Locus ID 25404
Gene Summary structural protein of lipid raft domains in the membrane called caveolae; functions as a cholesterol-binding/shuttling protein [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The resulting protein (isoform beta) is shorter but has the same C-terminus compared to isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.