Tac1 (NM_001124770) Rat Untagged Clone

CAT#: RN200477

Tac1 (untagged ORF) - Rat tachykinin 1 (Tac1), transcript variant 4, (10 ug)


  "NM_001124770" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tac1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Tac1
Synonyms Ppt5fl; PPTA3; RATPPTA3; TAC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200477 representing NM_001124770
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAATCCTCGTGGCGGTGGCGGTCTTTTTTCTCGTTTCCACTCAACTGTTTGCAGAGGAAATCGGTG
CCAACGATGATCTAAATTATTGGTCCGACTGGTCCGACAGTGACCAAATCAAGGAGGCAATGCCGGAGCC
CTTTGAGCATCTTCTTCAGAGAATCGCCCGAAGACCCAAGCCTCAGCAGTTCTTTGGATTAATGGGCAAA
CGGGATGCTGATTCCTCAATTGAAAAACAAGTGGCCCTGTTAAAGGCTCTTTATGGGCATGGTCAGATCT
CTCACAAAATGGCTTATGAAAGAAGCGCAATGCAGAACTACGAAAGAAGGCGTAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001124770
ORF Size 339 bp
Insert Size 339
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001124770.1, NP_001118242.1
RefSeq Size 995
RefSeq ORF 339
Locus ID 24806
Gene Summary encodes neuropeptides substance P, neurokinin A, neuropeptide K, and neuropeptide gamma [RGD, Feb 2006]
Transcript Variant: This variant (4) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform d).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.