Rps21 (NM_031111) Rat Untagged Clone

CAT#: RN204809

Rps21 (untagged ORF) - Rat ribosomal protein S21 (Rps21), (10 ug)


  "NM_031111" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rps21"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rps21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204809 representing NM_031111
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGAACGACGCCGGCGAGTTTGTGGACCTGTACGTGCCGCGGAAATGCTCCGCGAGCAACCGCATCA
TTGCTGCCAAGGACCACGCGTCCATCCAGATGAATGTGGCCGAGGTTGACAGGAGTACAGGCCGATTTAA
TGGTCAGTTTAAAACCTACGGCATCTGCGGGGCCATTCGCAGGATGGGCGAGTCAGATGATTCTATTCTC
CGATTGGCTAAGGCTGATGGAATTGTCTCAAAGAACTTTTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_031111
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_031111.1, NP_112373.1
RefSeq Size 359
RefSeq ORF 252
Locus ID 81775
Gene Summary ribosomal subunit protein [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.