Gpx2 (NM_183403) Rat Untagged Clone

CAT#: RN204828

Gpx2 (untagged ORF) - Rat glutathione peroxidase 2 (Gpx2), (Note, selenocysteine protein, internal stop codon, see reference data summary)

Specifications

Product Data

• Type: Rat Untagged Clone
• Symbol: Gpx2
• Synonyms: GPX-GI; GSHPx-2; GSHPx-GI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN204828 representing NM_183403
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTTACATCGCCAAGTCTTTTTACGATCTCAGTGCCATCGGCCTGGATGGGGAGAAGATAGACTTCA
  ACACGTTCCGAGGCAGGGCCGTGCTGATTGAGAATGTGGCCTCGCTCTGAGGAACAACTACCCGGGACTA
  CACCCAGCTCAATGAGTTGCAGTGCCGCTTTCCCAGGCGCCTAGTGGTTCTCGGCTTCCCTTGCAACCAG
  TTCGGACATCAGGAGAACTGTCAGAATGAGGAGATCCTGAACAGCCTCAAGTATGTCCGCCCTGGGGGTG
  GGTTCCAGCCCACCTTCAGTCTTACCCAAAAGTGTGATGTCAATGGGCAGAATCAGCATCCTGTCTTTGC
  CTACCTGAAAGACAAGCTGCCCTACCCTTATGACGACCCATTCTCCCTCATGACCGATCCCAAGCTCATC
  ATATGGAGTCCGGTGCGCCGCTCAGATGTGTCCTGGAACTTTGAGAAGTTCCTCATAGGGCCAGAAGGGG
  AGCCTTTCCGTCGCTACAGCCGCACCTTCCAGACCATCAACATCGAGCCTGACATCAAACGTCTCCTCAA
  AGTTGCCATCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_183403
• ORF Size: 573 bp
• Insert Size: 573
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_183403.2, NP_899653.2
• RefSeq Size: 1028
• RefSeq ORF: 573
• Locus ID: 29326
• Gene Summary: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is predominantly expressed in the gastrointestinal tract in rodents, is localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. Knockout studies in mice lacking this gene suggest a role for this isozyme in intestinal inflammation and colon cancer development. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Pseudogenes of this locus have been identified on chromosomes 2 and X. [provided by RefSeq, Aug 2017]