Rnaseh1 (NM_001013097) Rat Untagged Clone

CAT#: RN205003

Rnaseh1 (untagged ORF) - Rat ribonuclease H1 (Rnaseh1), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Rnaseh1
• Synonyms: MGC108918
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN205003 representing NM_001013097
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCGCTGGCTGCTGCCGCTGTTTCGCACTGTGACACTGGCCGTAGTGCGCGTCAGGCGAGGTGTTTGCG
  GGCTCGGCATGTTCTATGCGGTGAGGAGAGGCCGCAGGACCGGGGTCTTCCTGAGTTGGAGTGAGTGCAA
  AGCACAGGTGGACCGGTTCCCTGCTGCCAGGTTTAAGAAATTTGCCACAGAAGATGAGGCCTGGGCCTTT
  GTCAGGAGCTCTTCCAGTCCGGACGGTTCAAAAGGGCAGGAGAGTGCGCATGTGCAAAAGTTACAGGTGA
  AGACCAGCAAGCGGCCTCGGGAGCCTCTGGGTGAAGAGGAGGAACCTCCAGAGCCAGGGGCAAAGCACAC
  AAGACAGGACACGGAGCCAGCTGCTCTAGTGAGCAAGGATGCATTTTCTTATATGGGAGAGTCAGTCGTT
  GTCTACACGGATGGCTGTTGCTCCAGTAATGGGCGGAAGCGGGCACGAGCAGGAATCGGCGTTTACTGGG
  GGCCAGGCCACCCCTTAAATGTAGGCATAAGGCTTCCTGGGCGACAGACAAACCAGAGGGCTGAGATCCA
  TGCAGCCTGTAAAGCCATCACGCAAGCCAAGGCTCAGAACATCAGCAAGCTGGTCCTGTACACAGACAGC
  ATGTTCACCATCAACGGGATAACTAACTGGGTTCAGGGCTGGAAGAAGAATGGCTGGAGAACGAGTACAG
  GGAAAGACGTGATCAACAAGGAGGACTTCATGGAGCTGGATGAGCTCACCCAGGGCATGGACATCCAGTG
  GATGCACATTCCTGGCCACTCAGGATTTGTGGGCAACGAAGAAGCTGACAGACTGGCAAGGGAAGGAGCG
  AAGCAATCTGAGGGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001013097
• Insert Size: 858 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001013097.2, NP_001013115.1
• RefSeq Size: 1400 bp
• RefSeq ORF: 858 bp
• Locus ID: 298933
• Cytogenetics: 6q16
• Gene Summary: This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and is necessary for DNA replication and repair. This enzyme is present in both mitochondria and nuclei, which are resulted from translation of a single mRNA with two in-frame initiation start codons. The use of the first start codon produces the mitochondrial isoform and the use of the second start codon produces the nuclear isoform. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF) which encodes 7aa in rat. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (1) is derived from the upstream AUG start codon, while the shorter isoform (2) is derived from the downstream AUG start codon. This RefSeq represents the longer isoform (1), which is a mitochondrial protein (see details in PMID: 20823270).