Mt3 (NM_053968) Rat Untagged Clone

CAT#: RN205870

Mt3 (untagged ORF) - Rat metallothionein 3 (Mt3), (10 ug)


  "NM_053968" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mt3
Synonyms GIF; Mt-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN205870 representing NM_053968
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCCTGAGACCTGCCCCTGTCCTACTGGTGGTTCCTGCACCTGCTCGGACAAATGCAAATGCAAGG
GCTGCAAATGCACGAACTGCAAGAAGAGCTGCTGCTCCTGTTGCCCTGCAGGATGTGAGAAGTGTGCCAA
GGACTGTGTTTGCAAAGGCGAAGAGGGGGCCAAGGCCGAGAAATGCAGCTGCTGCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053968
ORF Size 201 bp
Insert Size 201
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053968.3, NP_446420.1
RefSeq Size 405
RefSeq ORF 201
Locus ID 117038
Gene Summary heavy metal binding protein; acts as an inhibitor of neurite sprouting and deficiency may play a role in Alzheimer's disease [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.