Pcp4 (NM_013002) Rat Untagged Clone

CAT#: RN207279

Pcp4 (untagged ORF) - Rat Purkinje cell protein 4 (Pcp4), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Pcp4
• Synonyms: pep-19; PEPZ19
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN207279 representing NM_013002
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTGAGAGACAAAGTGCTGGAGCGACCAATGGAAAAGACAAGACATCAGGAGATAATGATGGGCAGA
  AGAAGGTCCAAGAAGAATTTGATATCGACATGGATGCACCAGAGACAGAGCGTGCAGCTGTGGCCATTCA
  GTCTCAGTTCAGAAAATTCCAGAAGAAAAAGGCAGGATCACAGTCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013002
• ORF Size: 189 bp
• Insert Size: 189
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_013002.4, NP_037134.1
• RefSeq Size: 571
• RefSeq ORF: 189
• Locus ID: 25510
• Gene Summary: The protein encoded by this gene regulates H1˚ and H3.3 histone synthesis by binding to H1˚ and H3.3 histone mRNAs. The encoded protein can bind calmodulin as well, providung a possible link between calcium-dependent signals and histone metabolism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (1) represents the predominant transcript and encodes the smaller isoform (PEP19).