Tmsb4x (NM_031136) Rat Untagged Clone

CAT#: RN208281

Tmsb4x (untagged ORF) - Rat thymosin beta 4, X-linked (Tmsb4x), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Tmsb4x
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN208281 representing NM_031136
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAGTTGAAGAAGACAGAAACAC
  AAGAGAAAAATCCTCTGCCTTCAAAAGAAACAATTGAACAAGAGAAGCAAGCTGGCGAATCGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031136
• ORF Size: 135 bp
• Insert Size: 135
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_031136.1, NP_112398.1
• RefSeq Size: 686
• RefSeq ORF: 135
• Locus ID: 81814
• Gene Summary: may play a role in the regulation of actin dynamics; may be involved in osteoblast differentiation and immune response [RGD, Feb 2006]