Atp5j (NM_053602) Rat Untagged Clone

CAT#: RN209022

Atp5j (untagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 (Atp5j), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_053602" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Atp5j"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Atp5j
Synonyms Atp5j
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN209022 representing NM_053602
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTGTTCAGAGGATCTTCAGGCTCTCCTCTGTCCTTCGGTCAGCAGTCTCTGTGCATTTGAGGAGGA
ACATTGGTGTTACAGCTGTGGCGTTTAATAAGGAACTTGATCCTGTACAGAAACTCTTCTTGGACAAGAT
AAGAGAGTACAAAGCAAAGCGACTGGCGTCTGGAGGACCTGTTGATACTGGCCCAGAATATCAGCAAGAG
GTGGACAGAGAGCTTTTTAAGCTTAAACAAATGTATGGTAAAGGAGAGATGGATAAGTTTCCTACCTTCA
ATTTTGAGGATCCCAAATTTGAAGTCCTCGACAAACCCCAGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053602
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053602.2, NP_446054.1
RefSeq Size 571
RefSeq ORF 327
Locus ID 94271
Gene Summary coupling factor 6 of the mitochondrial ATP synthase complex [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.