Selenoh (NM_001114939) Rat Untagged Clone

CAT#: RN210725

RGD1563348 (untagged ORF) - Rat similar to Selenoprotein H (RGD1563348), (Note, selenocysteine protein, internal stop codon, see reference data summary)


  "NM_001114939" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Selenoh"

Specifications

Product Data
Type Rat Untagged Clone
Symbol Selenoh
Synonyms RGD1563348; Selh
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210725 representing NM_001114939
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCCTCTCGGAAGAAAGCGTAAGGCCGGGGCCGCGCCTATCGAGTCGGCGGACAAGCGCGAGAAAC
TGGCGGAGGGCGCGGCCGTGGTCATTGAGCATTGTACGAGCTGACGTGTCTACGGCCGCCATGCTGCTGC
CCTGAGCCAGGCTCTGCAACTGGAGGCCCCAGAGATATCTGTGCAAGTGAACCGGTCCAAGCCGCGGAGG
GGCAGCTTCGAAGTGACGCTGCTGCGCCCGGACAACAGTCGTGTTGAACTCTGGACTGGTATTAAGAAGG
GCCCTCCACGAAAGCTCAAATTTCCTGAGCCTCAAGAGATGGTTGAAGAATTGAAGAAGTACCTTTCATA
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001114939
ORF Size 351 bp
Insert Size 351
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
Reference Data
RefSeq NM_001114939.2, NP_001108411.1
RefSeq Size 735
RefSeq ORF 351
Locus ID 502642
Gene Summary This gene encodes a nucleolar protein, which belongs to the SelWTH family. It functions as an oxidoreductase, and has been shown to protect neurons against UVB-induced damage by inhibiting apoptotic cell death pathways, promote mitochondrial biogenesis and mitochondrial function, and suppress cellular senescence through genome maintenance and redox regulation. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2016]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.