Selenoh (NM_001114939) Rat Untagged Clone
CAT#: RN210725
RGD1563348 (untagged ORF) - Rat similar to Selenoprotein H (RGD1563348), (Note, selenocysteine protein, internal stop codon, see reference data summary)
"NM_001114939" in other vectors (3)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Symbol | Selenoh |
Synonyms | RGD1563348; Selh |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN210725 representing NM_001114939
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCCTCTCGGAAGAAAGCGTAAGGCCGGGGCCGCGCCTATCGAGTCGGCGGACAAGCGCGAGAAAC TGGCGGAGGGCGCGGCCGTGGTCATTGAGCATTGTACGAGCTGACGTGTCTACGGCCGCCATGCTGCTGC CCTGAGCCAGGCTCTGCAACTGGAGGCCCCAGAGATATCTGTGCAAGTGAACCGGTCCAAGCCGCGGAGG GGCAGCTTCGAAGTGACGCTGCTGCGCCCGGACAACAGTCGTGTTGAACTCTGGACTGGTATTAAGAAGG GCCCTCCACGAAAGCTCAAATTTCCTGAGCCTCAAGAGATGGTTGAAGAATTGAAGAAGTACCTTTCATA A ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001114939 |
ORF Size | 351 bp |
Insert Size | 351 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
Reference Data | |
RefSeq | NM_001114939.2, NP_001108411.1 |
RefSeq Size | 735 |
RefSeq ORF | 351 |
Locus ID | 502642 |
Gene Summary | This gene encodes a nucleolar protein, which belongs to the SelWTH family. It functions as an oxidoreductase, and has been shown to protect neurons against UVB-induced damage by inhibiting apoptotic cell death pathways, promote mitochondrial biogenesis and mitochondrial function, and suppress cellular senescence through genome maintenance and redox regulation. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2016] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR210725 | RGD1563348 (Myc-DDK-tagged ORF) - Rat similar to Selenoprotein H (RGD1563348), (10 ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
USD 420.00 |
|
RR210725L3 | Lenti ORF clone of RGD1563348 (Myc-DDK-tagged ORF) - Rat similar to Selenoprotein H (RGD1563348), (10 ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
USD 640.00 |
|
RR210725L4 | Lenti ORF clone of RGD1563348 (mGFP-tagged ORF) - Rat similar to Selenoprotein H (RGD1563348), (10 ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review