Tnp1 (NM_017056) Rat Untagged Clone

CAT#: RN210842

Tnp1 (untagged ORF) - Rat transition protein 1 (Tnp1), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Tnp1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN210842 representing NM_017056
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGACCAGCCGCAAACTAAAGACTCATGGCATGAGGAGAGGCAAGAACCGAGCTCCTCACAAGGGCG
  TCAAGAGAGGAGGAAGCAAGAGAAAATACCGGAAGAGCAGCCTGAAGAGTAGGAAACGGGGCGATGATGC
  AAGTCGCAATTACCGATCCCACTTGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_017056
• ORF Size: 168 bp
• Insert Size: 168
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_017056.2, NP_058752.1
• RefSeq Size: 439
• RefSeq ORF: 168
• Locus ID: 24839
• Gene Summary: spermatid transitional protein; highly basic protein expressed during the brief period when histones are being replaced by protamines in the haploid stage of spermatogenesis [RGD, Feb 2006]