Smpx (NM_053395) Rat Untagged Clone

CAT#: RN210934

Smpx (untagged ORF) - Rat small muscle protein, X-linked (Smpx), (10 ug)


  "NM_053395" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Smpx"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Smpx
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210934 representing NM_053395
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGAAGCAGCCAATTTCCAACGTCAGATCCATTCAGGCCAATATTAATATTCCAATGGGAGCCTTTC
GTCCGGGAGCTGGGCAGCCTCCCAGAAGGAAAGAGAGTACCCCTGGAACTGCGGAGGGAGCACCTGCTAC
TCCCGAGGAAAAGAAGCCAGTTCCTGGAATGAAGAAATTCCCAGGACCCGTCGTCAACCTGTCTGAGATC
CAAAACGTTAAAAGTGAACTAAAATACGTCCCCAAAGGTGAACAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053395
ORF Size 258 bp
Insert Size 258
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053395.1, NP_445847.1
RefSeq Size 892
RefSeq ORF 258
Locus ID 84416
Gene Summary homolog of a small human protein specifically expressed in striated muscle [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.