Prim1 (NM_001008768) Rat Untagged Clone

CAT#: RN211178

Prim1 (untagged ORF) - Rat DNA primase, p49 subunit (Prim1), (10 ug)


  "NM_001008768" in other vectors (3)

Reconstitution Protocol

USD 420.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "Prim1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Prim1
Synonyms MGC109113
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211178 representing NM_001008768
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTTTCCGCAGACATATGCTCCAAGTGCTGGACTCTCATGACAATGGCCATGCGCATCATAGATCGGG
CATTGAAGGAGGACTTTGGATTTAAGCACCGCCTCTGGGTGTATTCAGGAAGGAGAGGTGTACATTGTTG
GGTCTGTGATGAGTCTGTTCGAAAGCTGTCCTCTGCTGTTCGCTCCGGGATCGTGGAGTACTTGAGTCTT
ATAAAGGGTGGTCACGATGTTAAAAAGAAGGTTCACCTAAATGAGAAAGTTCACCCTTTTGTCAGAAAAT
CTATAAACATAATTAAAAAGTACTTTGAAGAATATGCCTTAGTTGACCAAGATATTCTTGAAAATAAAGA
AAACTGGGATAAGATTTTAGCCCTTGTTCCTGAGACAGTTCATGATGAGCTGCAAAAAGGGTTTCAGAGA
TTTCACAGTTCACCTCAGCGCTGGGAATACCTGAGGAAAGTGGCCAGTGCACCACAGAATACCAAGAATG
ATAAGTGTGGCCCCTGGCTAGAATGGGAGATTATGCTCCAGTACTGTTTCCCACGCCTGGATATCAACGT
CAGCAAAGGAGTCAACCATTTACTGAAGAGCCCTTTTAGTGTTCACCCTAAGACAGGTCGCATTTCTGTG
CCTATCGATTTTCAGAAAGTGGATCAGTTTGATCCATTTGTTGTTCCAACTATAAGTGCTATCTGCCGGG
AATTGGATGTGGTTTCCACCACTGAGAAGGAGAAGGAGGAAAATGAAACTGACAGCAGACACAGAGTCAG
AGATTATAAAAGGACCAGCCTAGCACCATACGTGAAAGTATTTGAACAGTTTCTCGAAAACCTGGATAAA
TCTCGGAAAGGGGCACTTCTCAAGAAGAGCGATTTACAAAAAGATTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001008768
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001008768.2, NP_001008768.2
RefSeq Size 1626 bp
RefSeq ORF 891 bp
Locus ID 246327
Cytogenetics 7q11
Gene Summary human homolog is the catalytic subunit of a primase complex that synthesizes small RNA primers to prime DNA replication [RGD, Feb 2006]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from genomic sequence data because no single transcript from the reference strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.