Fxyd5 (NM_021909) Rat Untagged Clone

CAT#: RN211689

Fxyd5 (untagged ORF) - Rat FXYD domain-containing ion transport regulator 5 (Fxyd5), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd5
• Synonyms: RIC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN211689 representing NM_021909
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCACCGCCCAGTCAGCTGTGTCTCCTCACCATTGTCGCCCTGATTCTGCCTAGTGAAGGGCAGACAC
  CAGAAAAACCCAGATCCAGTTTTACAGCGCACCAGAGTTCTGTGACTACTCATGTCCCAGTTCCAGATCA
  AACCAGCCCAGGAGTCCAGACCACTCCTCCCATCTGGACCAGTGAAGCTGGCGAAGCCACAGGAAGCCAG
  ACAGCAGCCAAAACCAAGACCCAGCAACTGACCGAAATGGCCACTGCGAATCCAGTGACAGATCCAGGGC
  CACTTACAAGCAGCGAGAAAGGTACCCCGGCACTCTCCAGGATCAAATCTCCCAGCCCACCCAAAGGTTA
  CATGCCTCCATCCTACATTGAGAATCCACTGGATCCCAATGAGAACAGCCCCTTCTACTACGACAATACC
  ACCCTCCGGAAACGGGGGCTGCTGGTGGCGGCAGTGCTGTTCATTACTGGAATTATCATCCTCACTAGTG
  GGAAGTGTAGACAGTTCTCTCAGTTATGCCTGAATCGCCACAGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021909
• ORF Size: 537 bp
• Insert Size: 537
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_021909.2, NP_068709.2
• RefSeq Size: 930
• RefSeq ORF: 537
• Locus ID: 60338
• Gene Summary: This reference sequence was derived from multiple replicate ESTs and validated by similar mouse cDNA sequence and human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. Three transcript variants encoding the same protein have been found for this gene. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000]
  Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein.