Cox7c (NM_001134705) Rat Untagged Clone

CAT#: RN213356

Cox7c (untagged ORF) - Rat cytochrome c oxidase, subunit VIIc (Cox7c), nuclear gene encoding mitochondrial protein, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Cox7c
• Synonyms: Cox7c1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN213356 representing NM_001134705
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTGGGCCAGAGTATCCGGAGGTTCACCACCTCCGTGGTGCGTCGCAGCCACTATGAGGAGGGTCCGG
  GGAAGAATTTGCCGTTTTCAGTGGAAAACAAGTGGCGGTTACTGCTTATGATGACCGTGTACTTTGGATC
  TGGATTTGCTGCTCCTTTCTTTATAGTAAGGCACCAGCTACTTAAAAAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001134705
• ORF Size: 192 bp
• Insert Size: 192
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001134705.1, NP_001128177.1
• RefSeq Size: 492
• RefSeq ORF: 192
• Locus ID: 100188937
• Gene Summary: This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]