Cox8c (NM_183055) Rat Untagged Clone

CAT#: RN213568

Cox8c (untagged ORF) - Rat cytochrome c oxidase, subunit 8C (Cox8c), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_183055" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cox8c"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cox8c
Synonyms COXVIII-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213568 representing NM_183055
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCGCTTGCTGCAGTTCTGCTCTTCCCTCCTCCGACACCGTGTAGTCCTGTTCTCGAAGCCTGGCC
ACTCAGGCCGCCTCAGCCACTCAGAAAGCCCACAAAACCAAGTCCTGACACCCACGGAATCGGTTGTTGG
AATTGTCGTGTTTTTTGCCACCTTTTTCATCCCAGCTGCGTATGTGATGAGCAACCTGAAGTTTTTCAAA
GGCGAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_183055
ORF Size 219 bp
Insert Size 219
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_183055.1, NP_898878.1
RefSeq Size 548
RefSeq ORF 219
Locus ID 360229
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.