Dbi (NM_031853) Rat Untagged Clone

CAT#: RN214369

Dbi (untagged ORF) - Rat diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) (Dbi), (10 ug)


  "NM_031853" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Dbi
Synonyms Acbp; Acoabp3; Ep; Odn; RNACOABP3; Ttn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214369 representing NM_031853
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCAGGCTGATTTCGACAAAGCCGCTGAGGAGGTGAAGCGCCTCAAGACTCAGCCAACTGATGAAG
AGATGCTGTTCATCTACAGCCACTTCAAACAAGCTACTGTGGGCGATGTAAACACAGATCGGCCGGGGCT
GTTGGACCTCAAGGGCAAAGCCAAGTGGGACTCGTGGAACAAGCTGAAAGGAACTTCCAAGGAAAATGCC
ATGAAGACCTATGTGGAAAAGGTAGAAGAGCTAAAGAAGAAATATGGAATATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_031853
ORF Size 264 bp
Insert Size 264
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_031853.4, NP_114054.1
RefSeq Size 593
RefSeq ORF 264
Locus ID 25045
Gene Summary plays a role in the regulation of mitochondrial steroidogenesis and acyl-CoA metabolism [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.