Crip1 (NM_001134933) Rat Untagged Clone

CAT#: RN214609

Crip1 (untagged ORF) - Rat cysteine-rich intestinal protein (Crip), (10 ug)


  "NM_001134933" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Crip1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Crip1
Synonyms Crip; Crp-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214609 representing NM_001134933
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAAGTGCCCCAAGTGCGACAAGGAGGTGTATTTCGCTGAGCGAGTGACGTCACTAGGCAAGGACT
GGCATCGTCCCTGCCTGAAGTGCGAGAAATGTGGAAAGACACTGACCTCTGGGGGTCATGCTGAGCATGA
AGGCAAGCCCTACTGCAACCATCCCTGCTACTCCGCCATGTTTGGGCCCAAAGGCTTTGGGCGAGGTGGA
GCTGAAAGCCACACTTTCAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001134933
ORF Size 234 bp
Insert Size 234
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001134933.2, NP_001128405.1
RefSeq Size 480
RefSeq ORF 234
Locus ID 691657
Gene Summary developmentally regulated LIM motif-containing zinc finger protein that may be involved in Th2 cytokine response [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.