Timm10 (NM_172074) Rat Untagged Clone

CAT#: RN214631

Timm10 (untagged ORF) - Rat translocase of inner mitochondrial membrane 10 homolog (yeast) (Timm10), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_172074" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Timm10"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Timm10
Synonyms Tim10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214631 representing NM_172074
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCCGCTCAGAGCCCAGCAACTGGCAGCGGAGCTGGAGGTGGAGATGATGGCCGACATGTACAACA
GAATGACCAGTGCCTGCCACCGGAAGTGCGTGCCTCCCCACTACAAGGAGGCAGAGCTGTCCAAAGGCGA
GTCTGTGTGTCTGGACCGATGCGTATCCAAGTACTTGGACATCCATGAGAGGATGGGAAAAAAGTTGACA
GAGTTGTCTATGCAGGATGAAGAGCTGATGAAGCGGGTACAGCAGAGCTCTGGGCCTGCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_172074
ORF Size 273 bp
Insert Size 273
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_172074.3, NP_742071.1
RefSeq Size 1167
RefSeq ORF 273
Locus ID 64464
Gene Summary human homolog is involved in the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.