Nnat (NM_001270867) Rat Untagged Clone

CAT#: RN215715

Nnat (untagged) - Rat neuronatin (Nnat), transcript variant 3


  "NM_001270867" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Nnat"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Nnat
Synonyms Peg5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215715 representing NM_001270867
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCAGTGGCAGCAGCCTCGGCAGAACTGCTCATCATCGGCTGGTACATCTTCCGCGTGCTGCTGC
AGGTGTTCCTGGAATGCTGCATTTACTGGGTGTTCAGGTACTCCCTGCAGAAGCTGGCGCACACGGTGTC
CCGGACCGGGCGGCAGGTGCTGGGGGAGCGCAGGCACCGAGCCCCCAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270867
ORF Size 192 bp
Insert Size 192
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001270867.1, NP_001257796.1
RefSeq Size 1231
RefSeq ORF 192
Locus ID 94270
Gene Summary may play a role in early postnatal brain development [RGD, Feb 2006]
Transcript Variant: This variant (3) uses an alternate in-frame donor splice site at an internal coding exon compared to variant 1, which results in a shorter isoform (3) missing an internal protein segment compared to isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.