Crip1 (NM_001244867) Rat Untagged Clone

CAT#: RN215745

Crip1 (untagged) - Rat cysteine-rich protein 1 (intestinal) (Crip1), transcript variant 1

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Crip1
• Synonyms: Crip; Crp-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215745 representing NM_001244867
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCGAAGTGCCCCAAGTGCGACAAGGAGGTGTATTTCGCTGAGCGAGTGACGTCACTAGGCAAGGACT
  GGCATCGTCCCTGCCTGAAGTGCGAGAAATGTGGAAAGACACTGACCTCTGGGGGTCATGCTGAGCATGA
  AGGCAAGCCCTACTGCAACCATCCCTGCTACTCCGCCATGTTTGGGCCCAAAGGCTTTGGGCGAGGTGGA
  GCTGAAAGCCACACTTTCAAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244867
• ORF Size: 234 bp
• Insert Size: 234
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001244867.1, NP_001231796.1
• RefSeq Size: 428
• RefSeq ORF: 234
• Locus ID: 691657
• Gene Summary: developmentally regulated LIM motif-containing zinc finger protein that may be involved in Th2 cytokine response [RGD, Feb 2006]
  Transcript Variant: This variant (1) is the predominant transcript. Variants 1 and 2 encode the same protein.