Pcp4 (NM_001270538) Rat Untagged Clone

CAT#: RN215788

Pcp4 (untagged) - Rat Purkinje cell protein 4 (Pcp4), transcript variant 2

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Pcp4
• Synonyms: pep-19; PEPZ19
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215788 representing NM_001270538
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAAAGACAAGACATCAGGAGATAATGGCAAAGTGCTCACTGCCAGAGGAGGAATGGAGAAGTGCCT
  GGCACGATCCAGCCAGAACCTGCTCGGTCTCTAAGAAAGCCAAGAGGATCTGCAGTGGAAATGCCTCGCT
  GGAGGCTCCTGAAATATATGGGCAGAAGAAGGTCCAAGAAGAATTTGATATCGACATGGATGCACCAGAG
  ACAGAGCGTGCAGCTGTGGCCATTCAGTCTCAGTTCAGAAAATTCCAGAAGAAAAAGGCAGGATCACAGT
  CCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270538
• ORF Size: 285 bp
• Insert Size: 285
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001270538.2, NP_001257467.1
• RefSeq Size: 698
• RefSeq ORF: 285
• Locus ID: 25510
• Gene Summary: The protein encoded by this gene regulates H1˚ and H3.3 histone synthesis by binding to H1˚ and H3.3 histone mRNAs. The encoded protein can bind calmodulin as well, providung a possible link between calcium-dependent signals and histone metabolism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (2) contains an alternate exon compared to variant 1, which causes a frameshift and use of a different start codon compared to variant 1. The resulting isoform (LPI) has a longer and distinct N-terminus compared to isoform PEP19. Experimental support for this transcript and isoform is provided in PMID:22020791 and PMID:17273800.