Cuta (NM_001164707) Rat Untagged Clone

CAT#: RN215918

Cuta (untagged) - Rat cutA divalent cation tolerance homolog (E. coli) (Cuta), transcript variant 2


  "NM_001164707" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cuta"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cuta
Synonyms CutA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215918 representing NM_001164707
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTGCCCTACTGCCGGTGGCTTCCCGCCTTCTATTGCTACCCCGAGCTCTGCTGTCCATGGCTTCTG
GAAGCCCTCCGTCCCAGCCGTCGCCGGCCTCGGGCTCCGGCTACGTTCCAGGATCAGTCTCTGCAGCCTT
TGTCACTTGTCCGAACGAAAAAGTCGCCAAGGAGATTGCCAGGGCAGTGGTAGAGAAGCGCCTGGCAGCC
TGCGTCAACCTCATCCCGCAGATCACATCCATCTATGAATGGAAAGGAAAGATCGAGGAAGATAGTGAGG
TGCTGATGATGATTAAAACACAAAGCTCCCTGGTCCCTGCTCTGACAGAGTTTGTCCGATCTGTGCACCC
TTATGAAGTTGCCGAGGTGATCGCACTGCCCGTGGAGCAGGGGAATCCCCCGTATCTGCACTGGGTGCAC
CAGGTCACGGAATCAGTGTCAGGCTCTGGCAAGGCCCTACCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164707
ORF Size 465 bp
Insert Size 465
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001164707.1, NP_001158179.1
RefSeq Size 718
RefSeq ORF 465
Locus ID 294288
Gene Summary may play a role in anchoring acetylcholinesterase in neuronal cell membranes; may be involved in signal transduction [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR and uses a downstream start codon compared to variant 1. Both variants 2 and 3 encode the same protein (isoform 2), which is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.