Fxyd5 (NM_001270688) Rat Untagged Clone

CAT#: RN215965

Fxyd5 (untagged) - Rat FXYD domain-containing ion transport regulator 5 (Fxyd5), transcript variant 2


  "NM_001270688" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fxyd5"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Fxyd5
Synonyms RIC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215965 representing NM_001270688
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCACCGCCCAGTCAGCTGTGTCTCCTCACCATTGTCGCCCTGATTCTGCCTAGTGAAGGGCAGACAC
CAGAAAAACCCAGATCCAGTTTTACAGCGCACCAGAGTTCTGTGACTACTCATGTCCCAGTTCCAGATCA
AACCAGCCCAGGAGTCCAGACCACTCCTCCCATCTGGACCAGTGAAGCTGGCGAAGCCACAGGAAGCCAG
ACAGCAGCCAAAACCAAGACCCAGCAACTGACCGAAATGGCCACTGCGAATCCAGTGACAGATCCAGGGC
CACTTACAAGCAGCGAGAAAGGTACCCCGGCACTCTCCAGGATCAAATCTCCCAGCCCACCCAAAGGTTA
CATGCCTCCATCCTACATTGAGAATCCACTGGATCCCAATGAGAACAGCCCCTTCTACTACGACAATACC
ACCCTCCGGAAACGGGGGCTGCTGGTGGCGGCAGTGCTGTTCATTACTGGAATTATCATCCTCACTAGTG
GGAAGTGTAGACAGTTCTCTCAGTTATGCCTGAATCGCCACAGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270688
ORF Size 537 bp
Insert Size 537
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001270688.1, NP_001257617.1
RefSeq Size 826
RefSeq ORF 537
Locus ID 60338
Gene Summary This reference sequence was derived from multiple replicate ESTs and validated by similar mouse cDNA sequence and human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. Three transcript variants encoding the same protein have been found for this gene. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.