Karyopherin beta 3 (IPO5) (BD027479) Human Untagged Clone

CAT#: SC105419

(untagged)-Sequence tag and encoded Human protein


Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "IPO5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IPO5
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for BD027479, the custom clone sequence may differ by one or more nucleotides


CTTCTCTCTCACGCCTAGCGCAATGGCGGCGGCCGCGGCGGASCAGCAACAGTTCTACCTGCTCCTGGGA
AACCTGCTCAGCCCCGACAATGTGGTCCGGAAACAGGCAGAGGAAACCTATGAGAATANTCCCAGGCCAG
TCAAAGATCACATTCCTCTTACAAGCCATCAGAAATACAACAGCTGCTGAAGAGGCTAGACAAATGGCCG
CCGTTCTCCTAAGACGTCTCTTGTCCTCTGCATTTGATGAAGTCTATCCAGCACTTCCCTCTGATGTTCA
GACTGCCATCAAGAGTGAGCTACTCATGATTATTCAGATGGAAACACAATCTAGCATGAGGAAAAAAGTT
TGTGATATTGCGGSAGAACTGGCCAGGAATTTAATAGATGAGGATGGCAATAACCAGTGGCCCGAAGTTT
GAAGTTCCTTTTTGATTCAGTCAG


>OriGene 5' read for BD027479 unedited
TGTATACGACTCATATAGGGCGGCCGCGAATCGGCACGAGGCGCCGGCGCCGGCGGCCGC
GGCGGGGTGAGAGGCCGCGAGGCCCCGCCCCGTCCTCCCCTTTCCCCTTTGCCCCGCCCT
TCCCGCGCGGCCCCCCGCAAGCCCCGCGCCGCCGCTGGTGCCGGTCCCCGCGCTGGGCCC
GCCCCCGCCCCTCCCGCGGCCCGCGAGCGCGCCTCACGGCTCCTGTCTCCCCTCCCTCCT
TCTCTCTCACGCCTAGCGCAATGGCGGCGGCCGCGGCGGAGCAGCAACAGTTCTACCTGC
TCCTGGGAAACCTGCTCAGCCCCGACAATGTGGTCCGGAAACAGGCAGAGGAAACCTATG
AGAATATCCCAGGCCAGTCAAAGATCACATTCCTCTTACAAGCCATCAGAAATACAACAG
CTGCTGAAGAGGCTAGACAAATGGCCGCCGTTCTCCTAAGACGTCTCTTGTCCTCTGCAT
TTGATGAAGTCTATCCAGCACTTCCCTCTGATGTTCAGACTGCCATCAAGAGTGAGCTAC
TCATGATTATTCAGATGGAAACACAATCTAGCATGAGGAAAAAAGTTTGTGATATTGCGG
CAGAACTGGCCAGGAATTTAATAGATGAAGGATGGCAATAACCAGTGGCCCGAAGGTTTT
GAAGTTCCTTTTTGATTCAGTCAGCTCTCAAATGTGGGACTGCGGGAAGCTGCCCTTCAC
ATTNTCTGGGAACTTCCTGGAATTTTTGGGGAACCAGCACACACTATNTTAGAGTCATAA
ACGAATGGTANTTCAGTGATGCAAGATCAGGACACCCGTCGATCANGACGTTATCTGCTA
AAGCACAGCTGCATTTATACTTGCAAAGAGCATAT
Restriction Sites NotI-NotI     
ACCN BD027479
Insert Size 3500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BD027479.1
RefSeq Size 444 bp
RefSeq ORF 444 bp
Locus ID 3843
Cytogenetics 13q32.2
Protein Families Druggable Genome
Gene Summary 'Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]'

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.