Placental lactogen (CSH2) (NM_022645) Human Untagged Clone

CAT#: SC112458

CSH2 (untagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSH2
• Synonyms: CS-2; CSB; GHB1; hCS-B; PL
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC112458 sequence for NM_022645 edited (data generated by NextGen Sequencing)
  ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGG
  CTTCAAGAGGCTGGTGCCGTCCAAACCGTTCCGTTATCCAGGCTTTTTGACCACGCTATG
  CTCCAAGCCCATCGCGCGCACCAGCTGGCCATTGACACCTACCAGGAGTTNNNNNNNGAA
  GACGGCAGCCGCCGGACTGGGCAGATCCTCAAGCAGACCTACAGCAAGTTTGACACAAAC
  TCACACAACCATGACGCACTGCTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGAC
  ATGGACAAGGTCGAGACATTCCTGCGCATGGTGCAGTGCCGCTCTGTAGAGGGTAGCTGT
  GGCTTCTAG
  
  Clone variation with respect to NM_022645.2
  171 t=>n;172 a=>n;173 g=>n;174 g=>n;175 c=>n;176 t=>n;177 g=>n
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_022645 unedited
  CACCAGCACAAAAGACCGGCTCTAGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGT
  CCTGTGGACAGCTCACCTAGCGGCAATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGC
  TTTTGCCCTGCTCTGCCTGCCCTGGCTTCAAGAGGCTGGTGCCGTCCAAACCGTTCCGTT
  ATCCAGGCTTTTTGACCACGCTATGCTCCAAGCCCATCGCGCGCACCAGCTGGCCATTGA
  CACCTACCAGGAGTTTGAAGAAACCTATATCCCAAAGGACCAGAAGTATTCATTCCTGCA
  TGACTCCCAGACCTCCTTCTGCTTCTCAGACTCTATTCCGACACCCTCCAACATGGAGGA
  AACGCAACAGAAATCCAATCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCGAGTCGTG
  GCTGGAGCCCGTGCGGTTCCTCAGGAGTATGTTCGCCAACAACCTGGTGTATGACACCTC
  GGACAGCGATGACTATCACCTCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGG
  GAGGCTGGAAGACGGCAGCCGCCGGACTGGGCAGATCCTCAAGCAGACCTACAGCAAGTT
  TGACACAAACTCACACAACCATGACGCACTGCTCAAGAACTACGGGCTGCTCTACTGCTT
  CAGGAAGGACATGGACAANGTCGAGACATTCCTGCGCATGGTGCAGTGCCGCTCTGTAGA
  GGGTAGCTGTGGCTTCTAAGTGCCCGCGTGGCATCCTGTG
  
• Restriction Sites: NotI-NotI
• ACCN: NM_022645
• Insert Size: 1000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_022645.2, NP_072171.1
• RefSeq Size: 598 bp
• RefSeq ORF: 369 bp
• Locus ID: 1443
• Cytogenetics: 17q23.3
• Protein Families: Secreted Protein
• Gene Summary: 'The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, while the ratio of 1 to 2 increases by term. Structural and expression differences provide avenues for developmental regulation and tissue specificity. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) lacks exons 3 and 4, and encodes an isoform (3) that has an internal deletion relative to isoform 1, but retains the signal sequence, unlike the other exon skipping isoform (4).