PCBP2 (NM_005016) Human Untagged Clone
CAT#: SC117008
PCBP2 (untagged)-Human poly(rC) binding protein 2 (PCBP2), transcript variant 1
"NM_005016" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PCBP2 |
Synonyms | hnRNP-E2; HNRNPE2; HNRPE2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_005016, the custom clone sequence may differ by one or more nucleotides
ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAGG AAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGTAT CAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTCAAA GCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCTGCCA GTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAAGGTGG ATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTACCCAAC TCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAGATCTGCG TGGTCATGTTGGAGACTCTCTCCCAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTC CAGCTCTCCGGTCATCTTTGCAGGTGGTCAGGACAGGTACAGCACAGGCAGCGACAGTGCGAGCTTTCCC CACACCACCCCGTCCATGTGCCTCAACCCTGACCTGGAGGGACCACCTCTAGAGGCCTATACCATTCAAG GACAGTATGCCATTCCACAGCCAGATTTGACCAAGCTGCACCAGTTGGCAATGCAACAGTCTCATTTTCC CATGACGCATGGCAACACCGGATTCAGTGGCATTGAATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGCA GGTTTGGATGCATCTGCTCAGACTACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAA TCGGGCGTCAAGGCGCCAAAATCAATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCC AGTGGAAGGATCTACTGATAGGCAGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATAT CTAATCAATGTCAGGCTTTCCTCGGAGACGGGTGGCATGGGGAGCAGCTAG |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_005016 |
Insert Size | 1680 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005016.5, NP_005007.2 |
RefSeq Size | 3187 bp |
RefSeq ORF | 1101 bp |
Locus ID | 5094 |
Cytogenetics | 12q13.13 |
Domains | KH |
Gene Summary | 'The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. This gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2018]' Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210035 | PCBP2 (Myc-DDK-tagged)-Human poly(rC) binding protein 2 (PCBP2), transcript variant 1 |
USD 420.00 |
|
RG210035 | PCBP2 (GFP-tagged) - Human poly(rC) binding protein 2 (PCBP2), transcript variant 1 |
USD 460.00 |
|
RC210035L1 | Lenti ORF clone of Human poly(rC) binding protein 2 (PCBP2), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC210035L2 | Lenti ORF clone of Human poly(rC) binding protein 2 (PCBP2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC210035L3 | Lenti ORF clone of Human poly(rC) binding protein 2 (PCBP2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC210035L4 | Lenti ORF clone of Human poly(rC) binding protein 2 (PCBP2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review