Profilin 1 (PFN1) (NM_005022) Human Untagged Clone

CAT#: SC117015

PFN1 (untagged)-Human profilin 1 (PFN1)


  "NM_005022" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PFN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFN1
Synonyms ALS18
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC117015 sequence for NM_005022 edited (data generated by NextGen Sequencing)
ATGGCCGGGTGGAACGCCTACATCGACAACCTCATGGCGGACGGGACCTGTCAGGACGCG
GCCATCGTGGGCTACAAGGACTCGCCCTCCGTCTGGGCCGCCGTCCCCGGGAAAACGTTC
GTCAACATCACGCCAGCTGAGGTGGGTGTCCTGGTTGGCAAAGACCGGTCAAGTTTTTAC
GTGAATGGGCTGACACTTGGGGGCCAGAAATGTTCGGTGATCCGGGACTCACTGCTGCAG
GATGGGGAATTTAGCATGGATCTTCGTACCAAGAGCACCGGTGGGGCCCCCACCTTCAAT
GTCACTGTCACCAAGACTGACAAGACGCTAGTCCTGCTGATGGGCAAAGAAGGTGTCCAC
GGTGGTTTGATCAACAAGAAATGTTATGAAATGGCCTCCCACCTTCGGCGTTCCCAGTAC
TGA

Clone variation with respect to NM_005022.2
>OriGene 5' read for NM_005022 unedited
GCACGAGGGCGGTCCGGACGGCAGCGCGTGCCCCGAGCTCTCCGCCTCCCCCCGCCCGCC
AGCCGAGGCAGCTCGAGCCCAGTCCGCGGCCCCAGCAGCAGCGCCGAGAGCAGCCCCAGT
AGCAGCGCCATGGCCGGGTGGAACGCCTACATCGACAACCTCATGGCGGACGGGACCTGT
CAGGACGCGGCCATCGTGGGCTACAAGGACTCGCCCTCCGTCTGGGCCGCCGTCCCCGGG
AAAACGTTCGTCAACATCACGCCAGCTGAGGTGGGTGTCCTGGTTGGCAAAGACCGGTCA
AGTTTTTACGTGAATGGGCTGACACTTGGGGGCCAGAAATGTTCGGTGATCCGGGACTCA
CTGCTGCAGGATGGGGAATTTAGCATGGATCTTCGTACCAAGAGCACCGGTGGGGCCCCC
ACCTTCAATGTCACTGTCACCAAGACTGACAAGACGCTAGTCCTGCTGATGGGCAAAGAA
GGTGTCCACGGTGGTTTGATCAACAAGAAATGTTATGAAATGGCCTCCCACCTTCGGCGT
TCCCAGTACTGACCTCGTCTGTCCCTTCCCCTTCACCGCTCCCCACAGCTTTGCACCCCT
TTCCTCCCCATACACACACAAACCAT
Restriction Sites NotI-NotI     
ACCN NM_005022
Insert Size 950 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005022.2, NP_005013.1
RefSeq Size 847 bp
RefSeq ORF 423 bp
Locus ID 5216
Cytogenetics 17p13.2
Domains PROF
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Regulation of actin cytoskeleton
Gene Summary 'This gene encodes a member of the profilin family of small actin-binding proteins. The encoded protein plays an important role in actin dynamics by regulating actin polymerization in response to extracellular signals. Deletion of this gene is associated with Miller-Dieker syndrome, and the encoded protein may also play a role in Huntington disease. Multiple pseudogenes of this gene are located on chromosome 1. [provided by RefSeq, Jul 2012]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.