Phospholamban (PLN) (NM_002667) Human Untagged Clone

CAT#: SC118501

PLN (untagged)-Human phospholamban (PLN)


  "NM_002667" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLN
Synonyms CMD1P; CMH18; PLB
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002667 edited
ATGGAGAAAGTCCAATACCTCACTCGCTCAGCTATAAGAAGAGCCTCAACCATTGAAATG
CCTCAACAAGCACGTCAAAAGCTACAGAATCTATTTATCAATTTCTGTCTCATCTTAATA
TGTCTCTTGCTGATCTGTATCATCGTGATGCTTCTCTGA
>OriGene 5' read for NM_002667 unedited
NTAACGTTCAGATTTGTAAACGACTCATATAGGCGGCCGCGNAATTCGNCCAGNANAAAA
CTCCCCAGCTAAACACCCGTAAGACTTCATACAACACAATACTCTATACTGTGATGATCA
CAGCTGCCAAGGCTACCTAAAAGAAGACAGTTATCTCATATTTGGCTGCCAGCTTTTTAT
CTTTCTCTCGACCACTTAAAACTTCAGACTTCCTGTCCTGCTGGTATCATGGAGAAAGTC
CAATACCTCACTCGCTCAGCTATAAGAAGAGCCTCAACCATTGAAATGCCTCAACAAGCA
CGTCAAAAGCTACAGAATCTATTTATCAATTTCTGTCTCATCTTAATATGTCTCTTGCTG
ATCTGTATCATCGTGATGCTTCTCTGAAGTTCTGCTACAACCTCTAGATCTGCAGCTTGC
CACATCAGCTTAAAATCTGTCATCCCATGCAGACAGGAAAACAATATTGTATAACAGACC
ACTTCCTGAGTAGAAGAGTTTCTTTGTGAAAAGGTCAAGATTAAGACTAAAACTTATTGT
TACCATATGTATTCATCTGTTGGATCTTGTAAACATGAAAAGGGCTTTATTTTCAAAAAT
TAACTTCAAAATAAGTGTATAAAATGCAACTGTTGATTTCCTCAACATGGCTCACAAATT
TCTATCCCAAATCTTTTCTGAAGATGAAGAGTTTAGTTTTAAAACTGCACTGCCAACAAG
TTCACTTCATATATAAAGCATTATTTTTACTCTTTTTGAGTGAATATAATTTATATTACC
ATGTANAAGCCTCTTTAATACTAAGTATTTTTCAGGTCTTCACCAAGTATCANNAGTATT
ACACANATGAAGTGTCATTATTCAAATAGTCCACTGACTCTCACATCTTGTATCTTAT
Restriction Sites NotI-NotI     
ACCN NM_002667
Insert Size 2600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002667.2, NP_002658.1
RefSeq Size 1712 bp
RefSeq ORF 159 bp
Locus ID 5350
Cytogenetics 6q22.31
Protein Families Transmembrane
Protein Pathways Calcium signaling pathway, Dilated cardiomyopathy
Gene Summary 'The protein encoded by this gene is found as a pentamer and is a major substrate for the cAMP-dependent protein kinase in cardiac muscle. The encoded protein is an inhibitor of cardiac muscle sarcoplasmic reticulum Ca(2+)-ATPase in the unphosphorylated state, but inhibition is relieved upon phosphorylation of the protein. The subsequent activation of the Ca(2+) pump leads to enhanced muscle relaxation rates, thereby contributing to the inotropic response elicited in heart by beta-agonists. The encoded protein is a key regulator of cardiac diastolic function. Mutations in this gene are a cause of inherited human dilated cardiomyopathy with refractory congestive heart failure, and also familial hypertrophic cardiomyopathy. [provided by RefSeq, Apr 2016]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.