CEACAM6 (NM_002483) Human Untagged Clone

CAT#: SC118611

CEACAM6 (untagged)-Human carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) (CEACAM6)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CEACAM6
• Synonyms: CD66c; CEAL; NCA
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC118611 sequence for NM_002483 edited (data generated by NextGen Sequencing)
  ATGGGACCCCCCTCAGCCCCTCCCTGCAGATTGCATGTCCCCTGGAAGGAGGTCCTGCTC
  ACAGCCTCACTTCTAACCTTCTGGAACCCACCCACCACTGCCAAGCTCACTATTGAATCC
  ACGCCGTTCAATGTCGCAGAGGGGAAGGAGGTTCTTCTACTCGCCCACAACCTGCCCCAG
  AATCGTATTGGTTACAGCTGGTACAAAGGCGAAAGAGTGGATGGCAACAGTCTAATTGTA
  GGATATGTAATAGGAACTCAACAAGCTACCCCAGGGCCCGCATACAGTGGTCGAGAGACA
  ATATACCCCAATGCATCCCTGCTGATCCAGAACGTCACCCAGAATGACACAGGATTCTAT
  ACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACCGGACAGTTCCATGTA
  TACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAACCCCGTGGAGGACAAG
  GATGCTGTGGCCTTCACCTGTGAACCTGAGGTTCAGAACACAACCTACCTGTGGTGGGTA
  AATGGTCAGAGCCTCCCGGTCAGTCCCAGGCTGCAGCTGTCCAATGGCAACATGACCCTC
  ACTCTACTCAGCGTCAAAAGGAACGATGCAGGATCCTATGAATGTGAAATACAGAACCCA
  GCGAGTGCCAACCGCAGTGACCCAGTCACCCTGAATGTCCTCTATGGCCCAGATGTCCCC
  ACCATTTCCCCCTCAAAGGCCAATTACCGTCCAGGGGAAAATCTGAACCTCTCCTGCCAC
  GCAGCCTCTAACCCACCTGCACAGTACTCTTGGTTTATCAATGGGACGTTCCAGCAATCC
  ACACAAGAGCTCTTTATCCCCAACATCACTGTGAATAATAGCGGATCCTATATGTGCCAA
  GCCCATAACTCAGCCACTGGCCTCAATAGGACCACAGTCACGATGATCACAGTCTCTGGA
  AGTGCTCCTGTCCTCTCAGCTGTGGCCACCGTCGGCATCACGATTGGAGTGCTGGCCAGG
  GTGGCTCTGATATAG
  
  Clone variation with respect to NM_002483.4
  716 g=>t
• Restriction Sites: Please inquire
• ACCN: NM_002483
• Insert Size: 2600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: A TrueClone in Neo vector.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002483.3, NP_002474.3
• RefSeq Size: 2527 bp
• RefSeq ORF: 1035 bp
• Locus ID: 4680
• Cytogenetics: 19q13.2
• Domains: ig
• Gene Summary: 'This gene encodes a protein that belongs to the carcinoembryonic antigen (CEA) family whose members are glycosyl phosphatidyl inositol (GPI) anchored cell surface glycoproteins. Members of this family play a role in cell adhesion and are widely used as tumor markers in serum immunoassay determinations of carcinoma. This gene affects the sensitivity of tumor cells to adenovirus infection. The protein encoded by this gene acts as a receptor for adherent-invasive E. coli adhesion to the surface of ileal epithelial cells in patients with Crohn's disease. This gene is clustered with genes and pseudogenes of the cell adhesion molecules subgroup of the CEA family on chromosome 19. [provided by RefSeq, Apr 2014]'