Galectin 1 (LGALS1) (NM_002305) Human Untagged Clone
CAT#: SC118705
LGALS1 (untagged)-Human lectin, galactoside-binding, soluble, 1 (LGALS1)
"NM_002305" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LGALS1 |
Synonyms | GAL1; GBP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_002305, the custom clone sequence may differ by one or more nucleotides
ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGG TGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAA CCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGG ACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACC AGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGC CATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_002305 |
Insert Size | 500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | no |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002305.3, NP_002296.1 |
RefSeq Size | 586 bp |
RefSeq ORF | 408 bp |
Locus ID | 3956 |
Cytogenetics | 22q13.1 |
Domains | Gal-bind_lectin |
Protein Families | Druggable Genome |
Gene Summary | 'The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204674 | LGALS1 (Myc-DDK-tagged)-Human lectin, galactoside-binding, soluble, 1 (LGALS1) |
USD 98.00 |
|
RG204674 | LGALS1 (GFP-tagged) - Human lectin, galactoside-binding, soluble, 1 (LGALS1) |
USD 460.00 |
|
RC204674L1 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 1 (LGALS1), Myc-DDK-tagged |
USD 768.00 |
|
RC204674L2 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 1 (LGALS1), mGFP tagged |
USD 768.00 |
|
RC204674L3 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 1 (LGALS1), Myc-DDK-tagged |
USD 620.00 |
|
RC204674L4 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 1 (LGALS1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review