HLF (NM_002126) Human Untagged Clone

CAT#: SC118800

HLF (untagged)-Human hepatic leukemia factor (HLF)


  "NM_002126" in other vectors (6)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HLF
Synonyms MGC33822
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_002126, the custom clone sequence may differ by one or more nucleotides


ATGGAGAAAATGTCCCGACCGCTCCCCCTGAATCCCACCTTTATCCCGCCTCCCTACGGCGTGCTCAGGT
CCCTGCTGGAGAACCCGCTGAAGCTCCCCCTTCACCACGAAGACGCATTTAGTAAAGATAAAGACAAGGA
AAAGAAGCTGGATGATGAGAGTAACAGCCCGACGGTCCCCCAGTCGGCATTCCTGGGGCCTACCTTATGG
GACAAAACCCTTCCCTATGACGGAGATACTTTCCAGTTGGAATACATGGACCTGGAGGAGTTTTTGTCAG
AAAATGGCATTCCCCCCAGCCCATCTCAGCATGACCACAGCCCTCACCCTCCTGGGCTGCAGCCAGCTTC
CTCGGCTGCCCCCTCGGTCATGGACCTCAGCAGCCGGGCCTCTGCACCCCTTCACCCTGGCATCCCATCT
CCGAACTGTATGCAGAGCCCCATCAGACCAGGTCAGCTGTTGCCAGCAAACCGCAATACACCAAGTCCCA
TTGATCCTGACACCATCCAGGTCCCAGTGGGTTATGAGCCAGACCCAGCAGATCTTGCCCTTTCCAGCAT
CCCTGGCCAGGAAATGTTTGACCCTCGCAAACGCAAGTTCTCTGAGGAAGAACTGAAGCCACAGCCCATG
ATCAAGAAAGCTCGCAAAGTCTTCATCCCTGATGACCTGAAGGATGACAAGTACTGGGCAAGGCGCAGAA
AGAACAACATGGCAGCCAAGCGCTCCCGCGACGCCCGGAGGCTGAAAGAGAACCAGATCGCCATCCGGGC
CTCGTTCCTGGAGAAGGAGAACTCGGCCCTCCGCCAGGAGGTGGCTGACTTGAGGAAGGAGCTGGGCAAA
TGCAAGAACATACTTGCCAAGTATGAGGCCAGGCACGGGCCCCTGTAG


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_002126
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002126.4, NP_002117.1
RefSeq Size 5607 bp
RefSeq ORF 888 bp
Locus ID 3131
Cytogenetics 17q22
Domains BRLZ
Protein Families Transcription Factors
Gene Summary 'This gene encodes a member of the proline and acidic-rich (PAR) protein family, a subset of the bZIP transcription factors. The encoded protein forms homodimers or heterodimers with other PAR family members and binds sequence-specific promoter elements to activate transcription. Chromosomal translocations fusing portions of this gene with the E2A gene cause a subset of childhood B-lineage acute lymphoid leukemias. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.