HLF (NM_002126) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HLF |
Synonyms | MGC33822 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002126, the custom clone sequence may differ by one or more nucleotides
ATGGAGAAAATGTCCCGACCGCTCCCCCTGAATCCCACCTTTATCCCGCCTCCCTACGGCGTGCTCAGGT CCCTGCTGGAGAACCCGCTGAAGCTCCCCCTTCACCACGAAGACGCATTTAGTAAAGATAAAGACAAGGA AAAGAAGCTGGATGATGAGAGTAACAGCCCGACGGTCCCCCAGTCGGCATTCCTGGGGCCTACCTTATGG GACAAAACCCTTCCCTATGACGGAGATACTTTCCAGTTGGAATACATGGACCTGGAGGAGTTTTTGTCAG AAAATGGCATTCCCCCCAGCCCATCTCAGCATGACCACAGCCCTCACCCTCCTGGGCTGCAGCCAGCTTC CTCGGCTGCCCCCTCGGTCATGGACCTCAGCAGCCGGGCCTCTGCACCCCTTCACCCTGGCATCCCATCT CCGAACTGTATGCAGAGCCCCATCAGACCAGGTCAGCTGTTGCCAGCAAACCGCAATACACCAAGTCCCA TTGATCCTGACACCATCCAGGTCCCAGTGGGTTATGAGCCAGACCCAGCAGATCTTGCCCTTTCCAGCAT CCCTGGCCAGGAAATGTTTGACCCTCGCAAACGCAAGTTCTCTGAGGAAGAACTGAAGCCACAGCCCATG ATCAAGAAAGCTCGCAAAGTCTTCATCCCTGATGACCTGAAGGATGACAAGTACTGGGCAAGGCGCAGAA AGAACAACATGGCAGCCAAGCGCTCCCGCGACGCCCGGAGGCTGAAAGAGAACCAGATCGCCATCCGGGC CTCGTTCCTGGAGAAGGAGAACTCGGCCCTCCGCCAGGAGGTGGCTGACTTGAGGAAGGAGCTGGGCAAA TGCAAGAACATACTTGCCAAGTATGAGGCCAGGCACGGGCCCCTGTAG |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_002126 |
Insert Size | 888 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002126.4, NP_002117.1 |
RefSeq Size | 5607 bp |
RefSeq ORF | 888 bp |
Locus ID | 3131 |
Cytogenetics | 17q22 |
Domains | BRLZ |
Protein Families | Transcription Factors |
Gene Summary | 'This gene encodes a member of the proline and acidic-rich (PAR) protein family, a subset of the bZIP transcription factors. The encoded protein forms homodimers or heterodimers with other PAR family members and binds sequence-specific promoter elements to activate transcription. Chromosomal translocations fusing portions of this gene with the E2A gene cause a subset of childhood B-lineage acute lymphoid leukemias. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206297 | HLF (Myc-DDK-tagged)-Human hepatic leukemia factor (HLF) |
USD 420.00 |
|
RG206297 | HLF (GFP-tagged) - Human hepatic leukemia factor (HLF) |
USD 460.00 |
|
RC206297L1 | Lenti ORF clone of Human hepatic leukemia factor (HLF), Myc-DDK-tagged |
USD 620.00 |
|
RC206297L2 | Lenti ORF clone of Human hepatic leukemia factor (HLF), mGFP tagged |
USD 620.00 |
|
RC206297L3 | Lenti ORF clone of Human hepatic leukemia factor (HLF), Myc-DDK-tagged |
USD 620.00 |
|
RC206297L4 | Lenti ORF clone of Human hepatic leukemia factor (HLF), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review