GHRHR (NM_000823) Human Untagged Clone
CAT#: SC119635
GHRHR (untagged)-Human growth hormone releasing hormone receptor (GHRHR)
"NM_000823" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GHRHR |
Synonyms | GHRFR; GRFR; IGHD1B; IGHD4 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_000823, the custom clone sequence may differ by one or more nucleotides
ATGGACCGCCGGATGTGGGGGGCCCACGTCTTCTGCGTGTTGAGCCCGTTACCGACCGTATTGGGCCACA TGCACCCAGAATGTGACTTCATCACCCAGCTGAGAGAGGATGAGAGTGCCTGTCTACAAGCAGCAGAGGA GATGCCCAACACCACCCTGGGCTGCCCTGCGACCTGGGATGGGCTGCTGTGCTGGCCAACGGCAGGCTCT GGCGAGTGGGTCACCCTCCCCTGCCCGGATTTCTTCTCTCACTTCAGCTCAGAGTCAGGGGCTGTGAAAC GGGATTGTACTATCACTGGCTGGTCTGAGCCCTTTCCACCTTACCCTGTGGCCTGCCCTGTGCCTCTGGA GCTGCTGGCTGAGGAGGAATCTTACTTCTCCACAGTGAAGATTATCTACACCGTGGGCCATAGCATCTCT ATTGTAGCCCTCTTCGTGGCCATCACCATCCTGGTTGCTCTCAGGAGGCTCCACTGCCCCCGGAACTACG TCCACACCCAGCTGTTCACCACTTTTATCCTCAAGGCGGGAGCTGTGTTCCTGAAGGATGCTGCCCTTTT CCACAGCGACGACACTGACCACTGCAGCTTCTCCACTGTTCTATGCAAGGTCTCTGTGGCCGCCTCCCAT TTCGCCACCATGACCAACTTCAGCTGGCTGTTGGCAGAAGCCGTCTACCTGAACTGCCTCCTGGCCTCCA CCTCCCCCAGCTCAAGGAGAGCCTTCTGGTGGCTGGTTCTCGCTGGCTGGGGGCTGCCCGTGCTCTTCAC TGGCACGTGGGTGAGCTGCAAACTGGCCTTCGAGGACATCGCGTGCTGGGACCTGGACGACACCTCCCCC TACTGGTGGATCATCAAAGGGCCCATTGTCCTCTCGGTCGGGGTGAACTTTGGGCTTTTTCTCAATATTA TCCGCATCCTGGTGAGGAAACTGGAGCCAGCTCAGGGCAGCCTCCATACCCAGTCTCAGTATTGGCGTCT CTCCAAGTCGACACTTTTCCTGATCCCACTCTTTGGAATTCACTACATCATCTTCAACTTCCTGCCAGAC AATGCTGGCCTGGGCATCCGCCTCCCCCTGGAGCTGGGACTGGGTTCCTTCCAGGGCTTCATTGTTGCCA TCCTCTACTGCTTCCTCAACCAAGAGGTGAGGACTGAGATCTCACGGAAGTGGCATGGCCATGACCCTGA GCTTCTGCCAGCCTGGAGGACCCGTGCTAAGTGGACCACGCCTTCCCGCTCGGCGGCAAAGGTGCTGACA TCTATGTGCTAG |
Restriction Sites | Please inquire |
ACCN | NM_000823 |
Insert Size | 1500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000823.2, NP_000814.2 |
RefSeq Size | 1614 bp |
RefSeq ORF | 1272 bp |
Locus ID | 2692 |
Cytogenetics | 7p14.3 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | 'This gene encodes a receptor for growth hormone-releasing hormone. Binding of this hormone to the receptor leads to synthesis and release of growth hormone. Mutations in this gene have been associated with isolated growth hormone deficiency (IGHD), also known as Dwarfism of Sindh, a disorder characterized by short stature. [provided by RefSeq, Jun 2010]' Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220054 | GHRHR (Myc-DDK-tagged)-Human growth hormone releasing hormone receptor (GHRHR) |
USD 420.00 |
|
RG220054 | GHRHR (GFP-tagged) - Human growth hormone releasing hormone receptor (GHRHR) |
USD 460.00 |
|
RC220054L1 | Lenti ORF clone of Human growth hormone releasing hormone receptor (GHRHR), Myc-DDK-tagged |
USD 768.00 |
|
RC220054L2 | Lenti ORF clone of Human growth hormone releasing hormone receptor (GHRHR), mGFP tagged |
USD 620.00 |
|
RC220054L3 | Lenti ORF clone of Human growth hormone releasing hormone receptor (GHRHR), Myc-DDK-tagged |
USD 620.00 |
|
RC220054L4 | Lenti ORF clone of Human growth hormone releasing hormone receptor (GHRHR), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review