MICA (NM_000247) Human Untagged Clone
CAT#: SC120030
MICA (untagged)-Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001)
"NM_000247" in other vectors (7)
Product Images
![](https://origeneresource2.s3.us-east-2.amazonaws.com/cmsstatics/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MICA |
Synonyms | MIC-A; PERB11.1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000247 edited
CGCCTTCTCCCCGGCCACTGCTTGAGCCGCTGAGAGGGTGGCGACGTCGGGGCCATGGGG CTGGGCCCGGTCTTCCTGCTTCTGGCTGGCATCTTCCCTTTTGCACCTCCGGGAGCTGCT GCTGAGCCCCACAGTCTTCGTTATAACCTCACGGTGCTGTCCTGGGATGGATCTGTGCAG TCAGGGTTTCTCACTGAGGTACATCTGGATGGTCAGCCCTTCCTGCGCTGTGACAGGCAG AAATGCAGGGCAAAGCCCCAGGGACAGTGGGCAGAAGATGTCCTGGGAAATAAGACATGG GACAGAGAGACCAGAGACTTGACAGGGAACGGAAAGGACCTCAGGATGACCCTGGCTCAT ATCAAGGACCAGAAAGAAGGCTTGCATTCCCTCCAGGAGATTAGGGTCTGTGAGATCCAT GAAGACAACAGCACCAGGAGCTCCCAGCATTTCTACTACGATGGGGAGCTCTTCCTCTCC CAAAACCTGGAGACTGAGGAATGGACAATGCCCCAGTCCTCCAGAGCTCAGACCTTGGCC ATGAACGTCAGGAATTTCTTGAAGGAAGATGCCATGAAGACCAAGACACACTATCACGCT ATGCATGCAGACTGCCTGCAGGAACTACGGCGATATCTAAAATCCGGCGTAGTCCTGAGG AGAACAGTGCCCCCCATGGTGAATGTCACCCGCAGCGAGGCCTCAGAGGGCAACATTACC GTGACATGCAGGGCTTCTGGCTTCTATCCCTGGAATATCACACTGAGCTGGCGTCAGGAT GGGGTATCTTTGAGCCACGACACCCAGCAGTGGGGGGATGTCCTGCCTGATGGGAATGGA ACCTACCAGACCTGGGTGGCCACCAGGATTTGCCAAGGAGAGGAGCAGAGGTTCACCTGC TACATGGAACACAGCGGGAATCACAGCACTCACCCTGTGCCCTCTGGGAAAGTGCTGGTG CTTCAGAGTCATTGGCAGACATTCCATGTTTCTGCTGTTGCTGCTGCTGCTATTTTTGTT ATTATTATTTTCTATGTCCGTTGTTGTAAGAAGAAAACATCAGCTGCAGAGGGTCCAGAG CTCGTGAGCCTGCAGGTCCTGGATCAACACCCAGTTGGGACGAGTGACCACAGGGATGCC ACACAGCTCGGATTTCAGCCTCTGATGTCAGATCTTGGGTCCACTGGCTCCACTGAGGGC ACCTAGACTCTACAGCCAGGCAGCTGGGATTCAATTCCCTGCCTGGATCTCACGAGCACT TTCCCTCTTGGTGCCTCAGTTTCCTGACCTATGAAACAGAGAAAATAAAAGCACTTATTT ATTGTTAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_000247 |
ORF Size | 1152 bp |
Insert Size | 1340 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000247.1. |
Reference Data | |
RefSeq | NM_000247.1, NP_000238.1 |
RefSeq Size | 1365 |
RefSeq ORF | 1152 |
Locus ID | 100507436 |
Domains | MHC_I, IGc1 |
Gene Summary | This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (1*001, also known as 1) is derived from the MICA*001 allele. It encodes the longest isoform (1). The MICA*001 allele is found in the c6_QBL (ALT_REF_LOCI_6) alternate assembly. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC323924 | MICA (untagged)-Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001) |
USD 310.00 |
|
RC204447 | MICA (Myc-DDK-tagged)-Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001) |
USD 420.00 |
|
RG204447 | MICA (GFP-tagged) - Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001) |
USD 460.00 |
|
RC204447L1 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), Myc-DDK-tagged |
USD 768.00 |
|
RC204447L2 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), mGFP tagged |
USD 620.00 |
|
RC204447L3 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), Myc-DDK-tagged |
USD 620.00 |
|
RC204447L4 | Lenti ORF clone of Human MHC class I polypeptide-related sequence A (MICA), transcript variant 1 (allele MICA*001), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review